PSMC2-proteasome (prosome, macropain) 26S subunit, ATPase, 2 Gene View larger

PSMC2-proteasome (prosome, macropain) 26S subunit, ATPase, 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMC2-proteasome (prosome, macropain) 26S subunit, ATPase, 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSMC2-proteasome (prosome, macropain) 26S subunit, ATPase, 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002589
Product type: DNA & cDNA
Ncbi symbol: PSMC2
Origin species: Human
Product name: PSMC2-proteasome (prosome, macropain) 26S subunit, ATPase, 2 Gene
Size: 2ug
Accessions: BC002589
Gene id: 5701
Gene description: proteasome (prosome, macropain) 26S subunit, ATPase, 2
Synonyms: MSS1; Nbla10058; 26S protease regulatory subunit 7; 26S proteasome AAA-ATPase subunit RPT1; mammalian suppressor of sgv-1 of yeast; protease 26S subunit 7; proteasome (prosome, macropain) 26S subunit, ATPase, 2; testis secretory sperm-binding protein Li 197a; proteasome 26S subunit, ATPase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggattacctcggtgccgatcagcggaagaccaaagaggatgagaaggacgacaagcccatccgagctctggatgagggggatattgccttgttgaaaacttatggtcagagcacttactctaggcagatcaagcaagttgaagatgacattcagcaacttctcaagaaaattaatgagctcactggtattaaagaatctgacactggcctggccccaccagcactctgggatttggctgcagataagcagacactccagagtgaacagcctttacaggttgccaggtgtacaaagataatcaatgctgattcggaggacccaaaatacattatcaacgtaaagcagtttgccaagtttgtggtggaccttagtgatcaggtggcacctactgacattgaagaagggatgagagtgggcgtggatagaaataaatatcaaattcacattccattgcctcctaagattgacccaacagttaccatgatgcaggtggaagagaaacctgatgtcacatacagtgatgttggtggctgtaaggaacagattgagaaactgcgagaagtagttgaaaccccattacttcatccagagaggtttgtgaaccttggcattgagcctcccaagggcgtgctgctctttggtccacccggtacaggcaagacactctgtgcgcgggcagttgctaatcggactgatgcgtgcttcattcgagttattggatctgagcttgtacagaaatacgtcggtgagggggctcgaatggttcgtgaactctttgaaatggccagaacaaaaaaagcctgccttatcttctttgatgaaattgatgctattggaggggctcgttttgatgatggtgctggaggtgacaatgaagtgcagagaacaatgttggaactgatcaatcagcttgatggttttgatcctcgaggcaatattaaagtgctgatggccactaacagacctgatactttggatccagcactgatgaggccagggagattggatagaaaaattgaatttagcttgcccgatctagagggtcggacccacatatttaagattcacgctcgttcaatgagtgttgaaagagatatcagatttgaactgttagcacgactgtgtccaaatagcactggtgctgagattagaagcgtctgcacagaggctggtatgtttgccatcagagcacggcgaaaaattgctaccgagaaggatttcttggaagctgtaaataaggtcattaagtcttatgccaaattcagtgctactcctcgttacatgacatacaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome P450, family 2, subfamily W, polypeptide 1
- proteasome (prosome, macropain) 26S subunit, ATPase, 1
- dopa decarboxylase (aromatic L-amino acid decarboxylase)
- SHC (Src homology 2 domain containing) family, member 4

Buy PSMC2-proteasome (prosome, macropain) 26S subunit, ATPase, 2 Gene now

Add to cart