Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMC2-proteasome (prosome, macropain) 26S subunit, ATPase, 2 Gene
PTXBC002589
New product
Data sheet of PSMC2-proteasome (prosome, macropain) 26S subunit, ATPase, 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMC2-proteasome (prosome, macropain) 26S subunit, ATPase, 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002589 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMC2 |
| Origin species: | Human |
| Product name: | PSMC2-proteasome (prosome, macropain) 26S subunit, ATPase, 2 Gene |
| Size: | 2ug |
| Accessions: | BC002589 |
| Gene id: | 5701 |
| Gene description: | proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
| Synonyms: | MSS1; Nbla10058; 26S protease regulatory subunit 7; 26S proteasome AAA-ATPase subunit RPT1; mammalian suppressor of sgv-1 of yeast; protease 26S subunit 7; proteasome (prosome, macropain) 26S subunit, ATPase, 2; testis secretory sperm-binding protein Li 197a; proteasome 26S subunit, ATPase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggattacctcggtgccgatcagcggaagaccaaagaggatgagaaggacgacaagcccatccgagctctggatgagggggatattgccttgttgaaaacttatggtcagagcacttactctaggcagatcaagcaagttgaagatgacattcagcaacttctcaagaaaattaatgagctcactggtattaaagaatctgacactggcctggccccaccagcactctgggatttggctgcagataagcagacactccagagtgaacagcctttacaggttgccaggtgtacaaagataatcaatgctgattcggaggacccaaaatacattatcaacgtaaagcagtttgccaagtttgtggtggaccttagtgatcaggtggcacctactgacattgaagaagggatgagagtgggcgtggatagaaataaatatcaaattcacattccattgcctcctaagattgacccaacagttaccatgatgcaggtggaagagaaacctgatgtcacatacagtgatgttggtggctgtaaggaacagattgagaaactgcgagaagtagttgaaaccccattacttcatccagagaggtttgtgaaccttggcattgagcctcccaagggcgtgctgctctttggtccacccggtacaggcaagacactctgtgcgcgggcagttgctaatcggactgatgcgtgcttcattcgagttattggatctgagcttgtacagaaatacgtcggtgagggggctcgaatggttcgtgaactctttgaaatggccagaacaaaaaaagcctgccttatcttctttgatgaaattgatgctattggaggggctcgttttgatgatggtgctggaggtgacaatgaagtgcagagaacaatgttggaactgatcaatcagcttgatggttttgatcctcgaggcaatattaaagtgctgatggccactaacagacctgatactttggatccagcactgatgaggccagggagattggatagaaaaattgaatttagcttgcccgatctagagggtcggacccacatatttaagattcacgctcgttcaatgagtgttgaaagagatatcagatttgaactgttagcacgactgtgtccaaatagcactggtgctgagattagaagcgtctgcacagaggctggtatgtttgccatcagagcacggcgaaaaattgctaccgagaaggatttcttggaagctgtaaataaggtcattaagtcttatgccaaattcagtgctactcctcgttacatgacatacaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 2, subfamily W, polypeptide 1 - proteasome (prosome, macropain) 26S subunit, ATPase, 1 - dopa decarboxylase (aromatic L-amino acid decarboxylase) - SHC (Src homology 2 domain containing) family, member 4 |