PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene View larger

PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene

PTXBC000343

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000343
Product type: DNA & cDNA
Ncbi symbol: PSMC4
Origin species: Human
Product name: PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene
Size: 2ug
Accessions: BC000343
Gene id: 5704
Gene description: proteasome (prosome, macropain) 26S subunit, ATPase, 4
Synonyms: MIP224; RPT3; TBP-7; TBP7; 26S protease regulatory subunit 6B; 26S proteasome AAA-ATPase subunit RPT3; MB67-interacting protein; Tat-binding protein 7; protease 26S subunit 6; proteasome (prosome, macropain) 26S subunit, ATPase, 4; proteasome 26S subunit, ATPase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagataggcatcttggtggagaaggctcaggatgagatcccagcactgtccgtgtcccggccccagaccggcctgtccttcctgggccctgagcctgaggacctggaggacctgtacagccgctacaagaagctgcagcaagagctggagttcctggaggtgcaggaggaatacatcaaagatgagcaaaagaacctgaaaaaggaatttctccatgcccaggaggaggtgaagcgaatccaaagcatcccgctggtcatcggacaatttctggaggctgtggatcagaatacagccatcgtgggctctaccacaggctccaactattatgtgcgcatcctgagcaccatcgatcgggagctgctcaagcccaacgcctcagtggccctccacaagcacagcaatgcactggtggacgtgctgccccccgaagccgacagcagcatcatgatgctcacctcagaccagaagccagatgtgatgtacgcggacatcggaggcatggacatccagaagcaggaggtgcgggaggccgtggagctcccgctcacgcatttcgagctctacaagcagatcggcatcgatcccccccgaggcgtcctcatgtatggcccacctggctgtgggaagaccatgttggcaaaggcggtggcacatcacacaacagctgcattcatccgggtcgtgggctcggagtttgtacagaagtatctgggtgagggcccccgcatggtccgggatgtgttccgcctggccaaggagaatgcacctgccatcatcttcatagacgagattgatgccatcgccaccaagagattcgatgctcagacaggggccgacagggaggttcagaggatcctgctggagctgctgaatcagatggatggatttgatcagaatgtcaatgtcaaggtaatcatggccacaaacagagcagacaccctggatccggccctgctacggccaggacggctggaccgtaaaattgaatttccacttcctgaccgccgccagaagagattgattttctccactatcactagcaagatgaacctctctgaggaggttgacttggaagactatgtggcccggccagataagatttcaggagctgatattaactccatctgtcaggagagtggaatgttggctgtccgtgaaaaccgctacattgtcctggccaaggacttcgagaaagcatacaagactgtcatcaagaaggacgagcaggagcatgagttttacaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) 26S subunit, ATPase, 2
- cytochrome P450, family 2, subfamily W, polypeptide 1
- proteasome (prosome, macropain) 26S subunit, ATPase, 1
- dopa decarboxylase (aromatic L-amino acid decarboxylase)

Buy PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene now

Add to cart