PIP4K2A-phosphatidylinositol-5-phosphate 4-kinase, type II, alpha Gene View larger

PIP4K2A-phosphatidylinositol-5-phosphate 4-kinase, type II, alpha Gene

PTXBC018034

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIP4K2A-phosphatidylinositol-5-phosphate 4-kinase, type II, alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PIP4K2A-phosphatidylinositol-5-phosphate 4-kinase, type II, alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018034
Product type: DNA & cDNA
Ncbi symbol: PIP4K2A
Origin species: Human
Product name: PIP4K2A-phosphatidylinositol-5-phosphate 4-kinase, type II, alpha Gene
Size: 2ug
Accessions: BC018034
Gene id: 5305
Gene description: phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Synonyms: PI5P4KA; PIP5K2A; PIP5KII-alpha; PIP5KIIA; PIPK; phosphatidylinositol 5-phosphate 4-kinase type-2 alpha; 1-phosphatidylinositol 5-phosphate 4-kinase 2-alpha; 1-phosphatidylinositol-4-phosphate kinase; 1-phosphatidylinositol-4-phosphate-5-kinase; PI(5)P 4-kinase type II alpha; PIP4KII-alpha; PIP5KIII; PIP5KIIalpha; PtdIns(4)P-5-kinase B isoform; diphosphoinositide kinase 2-alpha; phosphatidylinositol 5-phosphate 4-kinase type II alpha; phosphatidylinositol-4-phosphate 5-kinase, type II, alpha; ptdIns(4)P-5-kinase C isoform; ptdIns(5)P-4-kinase isoform 2-alpha; type II phosphatidylinositol-4-phosphate 5-kinase 53 K isoform; phosphatidylinositol-5-phosphate 4-kinase type 2 alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgacccccggcaacctagggtcctctgtcctggcgagcaagaccaagaccaagaagaagcacttcgtagcgcagaaagtgaagctgtttcgggccagcgacccgctgctcagcgtcctcatgtggggggtaaaccactcgatcaatgaactgagccatgttcaaatccctgttatgttgatgccagatgacttcaaagcctattcaaaaataaaggtggacaatcacctttttaacaaagaaaacatgccgagccatttcaagtttaaggaatactgcccgatggtcttccgtaacctgcgggagaggtttggaattgatgatcaagatttccagaattccctgaccaggagcgcacccctccccaacgactcccaggcccgcagtggagctcgttttcacacttcctacgacaaaagatacatcatcaagactattaccagtgaagacgtggccgaaatgcacaacatcctgaagaaataccaccagtacatagtggaatgtcatgggatcacccttcttccccagttcttgggcatgtaccggcttaatgttgatggagttgaaatatatgtgatagttacaagaaatgtattcagccaccgtttgtctgtgtataggaaatacgacttaaagggctctacagtggctagagaagctagtgacaaagaaaaggccaaagaactgccaactctgaaagataatgatttcattaatgagggccaaaagatttatattgatgacaacaacaagaaggtcttcctggaaaaactaaaaaaggatgttgagtttctggcccagctgaagctcatggactacagtctgctggtgggaattcatgatgtggagagagccgaacaggaggaagtggagtgtgaggagaacgatggggaggaggagggcgagagcgatggcacccacccggtgggaacccccccagatagccccgggaatacactgaacagctcaccacccctggctcccggggagttcgatccgaacatcgacgtctatggaattaagtgccatgaaaactcgcctaggaaggaggtgtacttcatggcaattattgacatccttactcattatgatgcaaaaaagaaagctgcccatgctgcaaaaactgttaaacatggcgctggcgcggagatctccaccgtgaacccagaacagtattcaaagcgctttttggactttattggccacatcttgacgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
- nudix (nucleoside diphosphate linked moiety X)-type motif 3
- nudix (nucleoside diphosphate linked moiety X)-type motif 4
- CASP2 and RIPK1 domain containing adaptor with death domain

Buy PIP4K2A-phosphatidylinositol-5-phosphate 4-kinase, type II, alpha Gene now

Add to cart