P2RX4-purinergic receptor P2X, ligand-gated ion channel, 4 Gene View larger

P2RX4-purinergic receptor P2X, ligand-gated ion channel, 4 Gene

PTXBC033826

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of P2RX4-purinergic receptor P2X, ligand-gated ion channel, 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about P2RX4-purinergic receptor P2X, ligand-gated ion channel, 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033826
Product type: DNA & cDNA
Ncbi symbol: P2RX4
Origin species: Human
Product name: P2RX4-purinergic receptor P2X, ligand-gated ion channel, 4 Gene
Size: 2ug
Accessions: BC033826
Gene id: 5025
Gene description: purinergic receptor P2X, ligand-gated ion channel, 4
Synonyms: P2X4R; P2X purinoceptor 4; ATP receptor; ATP-gated cation channel protein; P2X receptor, subunit 4; purinergic receptor P2X, ligand gated ion channel, 4; purinergic receptor P2X4; purinoceptor P2X4; purinergic receptor P2X 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggctgctgcgccgcgctggcggccttcctgttcgagtacgacacgccgcgcatcgtgctcatccgcagccgcaaagtggggctcatgaaccgcgccgtgcaactgctcatcctggcctacgtcatcgggtgggtgtttgtgtgggaaaagggctaccaggaaactgactccgtggtcagctccgttacgaccaaggtcaagggcgtggctgtgaccaacacttctaaacttggattccggatctgggatgtggcggattatgtgataccagctcaggaggaaaactccctcttcgtcatgaccaacgtgatcctcaccatgaaccagacacagggcctgtgccccgagattccagatgcgaccactgtgtgtaaatcagatgccagctgtactgccggctctgccggcacccacagcaacggagtctcaacaggcaggtgcgtagctttcaacgggtccgtcaagacgtgtgaggtggcggcctggtgcccggtggaggatgacacacacgtgccacaacctgcttttttaaaggctgcagaaaacttcactcttttggttaagaacaacatctggtatcccaaatttaatttcagcaagaggaatatccttcccaacatcaccactacttacctcaagtcgtgcatttatgatgctaaaacagatcccttctgccccatattccgtcttggcaaaatagtggagaacgcaggacacggtttccaggacatggccgtggagggaggcatcatgggcatccaggtcaactgggactgcaacctggacagagccgcctccctctgcttgcccaggtactccttccgccgcctcgatacacgggacgttgagcacaacgtatctcctggctacaatttcaggtttgccaagtactacagagacctggctggcaacgagcagcgcacgctcatcaaggcctatggcatccgcttcgacatcattgtgtttgggaaggcagggaaatttgacatcatccccactatgatcaacatcggctctggcctggcactgctaggcatggcgaccgtgctgtgtgacatcatagtcctctactgcatgaagaaaagactctactatcgggagaagaaatataaatatgtggaagattacgagcagggtcttgctagtgagctggaccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear autoantigenic sperm protein (histone-binding)
- tRNA splicing endonuclease 2 homolog (S. cerevisiae)
- APEX nuclease (apurinic/apyrimidinic endonuclease) 2
- karyopherin alpha 2 (RAG cohort 1, importin alpha 1)

Buy P2RX4-purinergic receptor P2X, ligand-gated ion channel, 4 Gene now

Add to cart