Cart 1 Product Products 113,40 € (empty)
-
1 x IGF2-insul...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
P2RX4-purinergic receptor P2X, ligand-gated ion channel, 4 Gene
PTXBC033826
New product
Data sheet of P2RX4-purinergic receptor P2X, ligand-gated ion channel, 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about P2RX4-purinergic receptor P2X, ligand-gated ion channel, 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033826 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | P2RX4 |
| Origin species: | Human |
| Product name: | P2RX4-purinergic receptor P2X, ligand-gated ion channel, 4 Gene |
| Size: | 2ug |
| Accessions: | BC033826 |
| Gene id: | 5025 |
| Gene description: | purinergic receptor P2X, ligand-gated ion channel, 4 |
| Synonyms: | P2X4R; P2X purinoceptor 4; ATP receptor; ATP-gated cation channel protein; P2X receptor, subunit 4; purinergic receptor P2X, ligand gated ion channel, 4; purinergic receptor P2X4; purinoceptor P2X4; purinergic receptor P2X 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgggctgctgcgccgcgctggcggccttcctgttcgagtacgacacgccgcgcatcgtgctcatccgcagccgcaaagtggggctcatgaaccgcgccgtgcaactgctcatcctggcctacgtcatcgggtgggtgtttgtgtgggaaaagggctaccaggaaactgactccgtggtcagctccgttacgaccaaggtcaagggcgtggctgtgaccaacacttctaaacttggattccggatctgggatgtggcggattatgtgataccagctcaggaggaaaactccctcttcgtcatgaccaacgtgatcctcaccatgaaccagacacagggcctgtgccccgagattccagatgcgaccactgtgtgtaaatcagatgccagctgtactgccggctctgccggcacccacagcaacggagtctcaacaggcaggtgcgtagctttcaacgggtccgtcaagacgtgtgaggtggcggcctggtgcccggtggaggatgacacacacgtgccacaacctgcttttttaaaggctgcagaaaacttcactcttttggttaagaacaacatctggtatcccaaatttaatttcagcaagaggaatatccttcccaacatcaccactacttacctcaagtcgtgcatttatgatgctaaaacagatcccttctgccccatattccgtcttggcaaaatagtggagaacgcaggacacggtttccaggacatggccgtggagggaggcatcatgggcatccaggtcaactgggactgcaacctggacagagccgcctccctctgcttgcccaggtactccttccgccgcctcgatacacgggacgttgagcacaacgtatctcctggctacaatttcaggtttgccaagtactacagagacctggctggcaacgagcagcgcacgctcatcaaggcctatggcatccgcttcgacatcattgtgtttgggaaggcagggaaatttgacatcatccccactatgatcaacatcggctctggcctggcactgctaggcatggcgaccgtgctgtgtgacatcatagtcctctactgcatgaagaaaagactctactatcgggagaagaaatataaatatgtggaagattacgagcagggtcttgctagtgagctggaccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear autoantigenic sperm protein (histone-binding) - tRNA splicing endonuclease 2 homolog (S. cerevisiae) - APEX nuclease (apurinic/apyrimidinic endonuclease) 2 - karyopherin alpha 2 (RAG cohort 1, importin alpha 1) |