TSEN2-tRNA splicing endonuclease 2 homolog (S. cerevisiae) Gene View larger

TSEN2-tRNA splicing endonuclease 2 homolog (S. cerevisiae) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSEN2-tRNA splicing endonuclease 2 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSEN2-tRNA splicing endonuclease 2 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004178
Product type: DNA & cDNA
Ncbi symbol: TSEN2
Origin species: Human
Product name: TSEN2-tRNA splicing endonuclease 2 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC004178
Gene id: 80746
Gene description: tRNA splicing endonuclease 2 homolog (S. cerevisiae)
Synonyms: TSEN2 tRNA splicing endonuclease subunit; PCH2B; SEN2; SEN2L; tRNA-splicing endonuclease subunit Sen2; hsSen2; tRNA-intron endonuclease Sen2; tRNA splicing endonuclease subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagaagcagttttccatgccccaaagaggaaaagaagagtgtatgagacttacgagtctccattgccaatcccttttggtcaggaccatggtcctctgaaagaattcaagatattccgtgctgaaatgattaacaacaatgtgattgtgaggaatgcggaggacattgagcagctctatgggaaaggttattttggaaaaggtattctttcaagaagccgtccaagcttcacaatttcagatcctaaactggttgctaaatggaaagatatgaagacaaacatgcctatcatcacatcaaagaggtatcagcatagtgttgagtgggcagcagagctgatgcgtagacaggggcaggatgagagtacagtgcgcagaatcctcaaggattacacgaaaccgcttgagcatcctcctgtgaaaaggaatgaagaggctcaagtgcatgacaagcttaactctggaatggtttccaacatggaaggcacagcagggggagagagaccttctgtggtaaacggggactctggaaagtcaggtggtgtgggtgatccccgtgagccattaggctgcctgcaggagggctctggctgccacccaacaacagagagctttgagaaaagcgtgcgagaggatgcctcacctctgccccatgtctgttgctgcaaacaagatgctctcatcctccagcgtggccttcatcatgaagacggcagccagcacatcggcctcctgcatcctggggacagagggcctgaccatgagtacgtgctggtcgaggaagcggagtgtgccatgagcgagagggaggctgccccaaatgaggaattggtgcaaagaaacaggttaatatgcagaagaaatccatataggatctttgagtatttgcaactcagcctagaagaggcctttttcttggtctatgctctgggatgtttaagtatttactatgagaaggagcctttaacgatagtgaagctctggaaagctttcactgtagttcagcccacgttcagaaccacctacatggcctaccattactttcgaagcaagggctgggtgcccaaagtgggactcaagtacgggacagatttactgctatatcggaaaggccctccattttaccatgcaagttattctgtcattatcgagctagttgatgaccattttgaaggctctctccgcaggcctctcagttggaagtccctggctgccttgagcagagtttccgttaatgtctctaaggaacttatgctgtgctatttgattaaaccctctactatgactgacaaggaaatggagtcaccagaatgtatgaaaaggattaaagttcaggaggtgattctgagtcgatgggtttcttcacgagagaggagtgaccaagacgatctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - APEX nuclease (apurinic/apyrimidinic endonuclease) 2
- karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
- staufen, RNA binding protein, homolog 2 (Drosophila)
- cleavage and polyadenylation specific factor 3-like

Buy TSEN2-tRNA splicing endonuclease 2 homolog (S. cerevisiae) Gene now

Add to cart