Login to display prices
Login to display prices
APEX2-APEX nuclease (apurinic/apyrimidinic endonuclease) 2 Gene View larger

APEX2-APEX nuclease (apurinic/apyrimidinic endonuclease) 2 Gene

PTXBC002959

New product

Data sheet of APEX2-APEX nuclease (apurinic/apyrimidinic endonuclease) 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about APEX2-APEX nuclease (apurinic/apyrimidinic endonuclease) 2 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC002959
Ncbi symbol: APEX2
Product name: APEX2-APEX nuclease (apurinic/apyrimidinic endonuclease) 2 Gene
Size: 2ug
Accessions: BC002959
Gene id: 27301
Gene description: APEX nuclease (apurinic/apyrimidinic endonuclease) 2
Synonyms: APE2; APEXL2; XTH2; ZGRF2; DNA-(apurinic or apyrimidinic site) lyase 2; AP endonuclease 2; AP endonuclease XTH2; APEX nuclease (apurinic/apyrimidinic endonuclease) 2; apurinic/apyrimidinic endonuclease-like 2; zinc finger, GRF-type containing 2; apurinic/apyrimidinic endodeoxyribonuclease 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgcgcgtggtgagctggaacatcaatgggattcggagacccctgcaaggggtggcaaatcaggaacccagcaactgtgccgccgtggccgtggggcgcattttggacgagctggatgcggatatcgtctgtctccaggaaaccaaagtgaccagggatgcactgacagagcccctggctatcgttgagggttataactcctatttcagcttcagccgcaaccgtagcggctattctggtgtagccaccttctgtaaggacaatgctaccccagtggctgctgaagaaggcctgagtggcctgtttgccacccagaatggggatgttggttgctatggaaacatggatgagtttacccaagaggaactccgggctctggatagtgagggcagggccctcctcacacagcataagatccgcacatgggaaggtaaggagaagaccttgaccctaatcaacgtgtactgcccccatgcggaccctgggaggcctgagcggctagtctttaagatgcgcttctatcgtttgctgcaaatccgagcagaagccctcctggcggcaggcagccatgtgatcattctgggtgacctgaatacagcccaccgccccattgaccactgggatgcagtcaacctggaatgctttgaagaggacccagggcgcaagtggatggacagcttgctcagtaacttggggtgccagtctgcctctcatgtagggcccttcatcgatagctaccgctgcttccaaccaaagcaggagggggccttcacctgctggtcagcagtcactggcgcccgccatctcaactatggctcccggcttgactatgtgctgggggacaggaccctggtcatagacacctttcaggcctctttcctgctgcctgaggtgatgggctctgaccactgccctgtgggtgcagtcttgagtgtgtcctctgtgcctgcaaaacagtgcccacctctgtgcacccgcttcctccctgagtttgcaggcacccagctcaagatccttcgcttcctagttcctctcgaacaaagtcctgtgttggagcagtcgacgctgcagcacaacaatcaaacccgggtacagacatgccaaaacaaagcccaagtgcgctcaaccaggcctcagcccagtcaggttggctctagcagaggccagaaaaacctgaagagctactttcagccctcccctagctgtccccaagcctctcctgacatagagctgcctagcctaccactgatgagcgccctcatgaccccgaagactccagaagagaaggcagtggccaaagtggtgaaggggcaggccaagacttcagaagccaaagatgagaaggagttacggacctcattctggaagtctgtgctggcggggcccttgcgcacacccctctgtgggggccacagggagccatgtgtgatgcgtactgtgaagaagccaggacccaacttgggccgccgcttctacatgtgtgccaggccccggggtcctcccactgacccctcctcccggtgcaacttcttcctctggagcaggcccagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: