Login to display prices
Login to display prices
KPNA2-karyopherin alpha 2 (RAG cohort 1, importin alpha 1) Gene View larger

KPNA2-karyopherin alpha 2 (RAG cohort 1, importin alpha 1) Gene

PTXBC005978

New product

Data sheet of KPNA2-karyopherin alpha 2 (RAG cohort 1, importin alpha 1) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KPNA2-karyopherin alpha 2 (RAG cohort 1, importin alpha 1) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC005978
Product type: DNA & cDNA
Ncbi symbol: KPNA2
Origin species: Human
Product name: KPNA2-karyopherin alpha 2 (RAG cohort 1, importin alpha 1) Gene
Size: 2ug
Accessions: BC005978
Gene id: 3838
Gene description: karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
Synonyms: IPOA1; QIP2; RCH1; SRP1-alpha; SRP1alpha; importin subunit alpha-1; RAG cohort protein 1; importin subunit alpha-2; importin-alpha-P1; karyopherin alpha 2 (RAG cohort 1, importin alpha 1); pendulin; karyopherin subunit alpha 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccaccaacgagaatgctaatacaccagctgcccgtcttcacagattcaagaacaagggaaaagacagtacagaaatgaggcgtcgcagaatagaggtcaatgtggagctgaggaaagctaagaaggatgaccagatgctgaagaggagaaatgtaagctcatttcctgatgatgctacttctccgctgcaggaaaaccgcaacaaccagggcactgtaaattggtctgttgatgacattgtcaaaggcataaatagcagcaatgtggaaaatcagctccaagctactcaagctgccaggaaactactttccagagaaaaacagccccccatagacaacataatccgggctggtttgattccgaaatttgtgtccttcttgggcagaactgattgtagtcccattcagtttgaatctgcttgggcactcactaacattgcttctgggacatcagaacaaaccaaggttgtggtagatggaggtgccatcccagcattcatttctctgttggcatctccccatgctcacatcagtgaacaagctgtctgggctctaggaaacattgcaggtgatggctcagtgttccgagacttggttattaagtacggtgcagttgacccactgttggctctccttgcagttcctgatatgtcatctttagcatgtggctacttacgtaatcttacctggacactttctaatctttgccgcaacaagaatcctgcacccccgatagatgctgttgagcagattcttcctaccttagttcggctcctgcatcatgatgatccagaagtattagcagatacctgctgggctatttcctaccttactgatggtccaaatgaacgaattggcatggtggtgaaaacaggagttgtgccccaacttgtgaagcttctaggagcttctgaattgccaattgtgactcctgccctaagagccatagggaatattgtcactggtacagatgaacagactcaggttgtgattgatgcaggagcactcgccgtctttcccagcctgctcaccaaccccaaaactaacattcagaaggaagctacgtggacaatgtcaaacatcacagccggccgccaggaccagatacagcaagttgtgaatcatggattagtcccattccttgtcagcgttctctctaaggcagattttaagacacaaaaggaagctgtgtgggccgtgaccaactataccagtggtggaacagttgaacagattgtgtaccttgttcactgtggcataatagaaccgttgatgaacctcttaactgcaaaagataccaagattattctggttatcctggatgccatttcaaatatctttcaggctgctgagaacctaggtgaaactgagaaacttagtataatgattgaagaatgtggaggcttagacaaaattgaagctctacaaaaccatgaaaatgagtctgtgtataaggcttcgttaagcttaattgagaagtatttctctgtagaggaagaggaagatcaaaacgttgtaccagaaactacctctgaaggctacactttccaagttcaggatggggctcctgggacctttaacttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - staufen, RNA binding protein, homolog 2 (Drosophila)
- cleavage and polyadenylation specific factor 3-like
- DIS3 mitotic control homolog (S. cerevisiae)-like 2
- small nucleolar RNA host gene 7 (non-protein coding)