SNHG7-small nucleolar RNA host gene 7 (non-protein coding) Gene View larger

SNHG7-small nucleolar RNA host gene 7 (non-protein coding) Gene

PTXBC007651

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNHG7-small nucleolar RNA host gene 7 (non-protein coding) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNHG7-small nucleolar RNA host gene 7 (non-protein coding) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007651
Product type: DNA & cDNA
Ncbi symbol: SNHG7
Origin species: Human
Product name: SNHG7-small nucleolar RNA host gene 7 (non-protein coding) Gene
Size: 2ug
Accessions: BC007651
Gene id: 84973
Gene description: small nucleolar RNA host gene 7 (non-protein coding)
Synonyms: NCRNA00061; small nucleolar RNA host gene 7 (non-protein coding)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggtacagaggccaaagacgcagctgcatgtcctgcagtgcctgggacgccccgtagtgaagagtgatgtggcccaaatgtcagcagtgccagtgtcagactcctgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SH3 domain containing, Ysc84-like 1 (S. cerevisiae)
- pleckstrin homology-like domain, family A, member 3
- pituitary tumor-transforming 1 interacting protein
- pituitary tumor-transforming 1 interacting protein

Buy SNHG7-small nucleolar RNA host gene 7 (non-protein coding) Gene now

Add to cart