SH3YL1-SH3 domain containing, Ysc84-like 1 (S. cerevisiae) Gene View larger

SH3YL1-SH3 domain containing, Ysc84-like 1 (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SH3YL1-SH3 domain containing, Ysc84-like 1 (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SH3YL1-SH3 domain containing, Ysc84-like 1 (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030778
Product type: DNA & cDNA
Ncbi symbol: SH3YL1
Origin species: Human
Product name: SH3YL1-SH3 domain containing, Ysc84-like 1 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC030778
Gene id: 26751
Gene description: SH3 domain containing, Ysc84-like 1 (S. cerevisiae)
Synonyms: RAY; SH3 domain-containing YSC84-like protein 1; SH3 domain containing, Ysc84-like 1; SH3 and SYLF domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaataaccatataccttccaatttgaaatcagaagcaaaaaaggctgccaaaatattaagagaattcacagaaataacttccagaaatggacctgataagatcattcctgctcacgtaattgcgaaggctaaaggccttgcaattctgtctgtgatcaaagccgggttcctggtgactgccagaggaggcagcgggattgtagtggcgcgccttccagatggaaaatggtctgcaccctcagccattgggatagctggccttggtggaggatttgaaataggaattgagacacatttacagctacatattccctctgagcattgccctggctgccttccataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pleckstrin homology-like domain, family A, member 3
- pituitary tumor-transforming 1 interacting protein
- pituitary tumor-transforming 1 interacting protein
- DR1-associated protein 1 (negative cofactor 2 alpha)

Buy SH3YL1-SH3 domain containing, Ysc84-like 1 (S. cerevisiae) Gene now

Add to cart