Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SH3YL1-SH3 domain containing, Ysc84-like 1 (S. cerevisiae) Gene
PTXBC030778
New product
Data sheet of SH3YL1-SH3 domain containing, Ysc84-like 1 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SH3YL1-SH3 domain containing, Ysc84-like 1 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030778 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SH3YL1 |
| Origin species: | Human |
| Product name: | SH3YL1-SH3 domain containing, Ysc84-like 1 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC030778 |
| Gene id: | 26751 |
| Gene description: | SH3 domain containing, Ysc84-like 1 (S. cerevisiae) |
| Synonyms: | RAY; SH3 domain-containing YSC84-like protein 1; SH3 domain containing, Ysc84-like 1; SH3 and SYLF domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaataaccatataccttccaatttgaaatcagaagcaaaaaaggctgccaaaatattaagagaattcacagaaataacttccagaaatggacctgataagatcattcctgctcacgtaattgcgaaggctaaaggccttgcaattctgtctgtgatcaaagccgggttcctggtgactgccagaggaggcagcgggattgtagtggcgcgccttccagatggaaaatggtctgcaccctcagccattgggatagctggccttggtggaggatttgaaataggaattgagacacatttacagctacatattccctctgagcattgccctggctgccttccataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology-like domain, family A, member 3 - pituitary tumor-transforming 1 interacting protein - pituitary tumor-transforming 1 interacting protein - DR1-associated protein 1 (negative cofactor 2 alpha) |