Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PHLDA3-pleckstrin homology-like domain, family A, member 3 Gene
PTXBC014390
New product
Data sheet of PHLDA3-pleckstrin homology-like domain, family A, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PHLDA3-pleckstrin homology-like domain, family A, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014390 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PHLDA3 |
| Origin species: | Human |
| Product name: | PHLDA3-pleckstrin homology-like domain, family A, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC014390 |
| Gene id: | 23612 |
| Gene description: | pleckstrin homology-like domain, family A, member 3 |
| Synonyms: | TIH1; pleckstrin homology-like domain family A member 3; TDAG51/Ipl homolog 1; pleckstrin homology-like domain, family A, member 2; pleckstrin homology like domain family A member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacggcggcggcgacggctaccgtgctcaaggagggcgtgctggagaagcgcagcggcgggctgctgcagctgtggaagcggaagcgctgcgtcctcaccgaacgcgggctgcagctcttcgaggccaagggcacgggcggccggcccaaggagctcagcttcgcccgcatcaaggccgtggagtgcgtggagagcaccgggcgccacatctacttcacgctggtgaccgaagggggcggcgagatcgacttccgctgccccctggaagatcccggctggaacgcccagatcaccctaggcctggtcaagttcaagaaccagcaggccatccagacagtgcgggcccggcagagcctcgggaccgggaccctcgtgtcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pituitary tumor-transforming 1 interacting protein - pituitary tumor-transforming 1 interacting protein - DR1-associated protein 1 (negative cofactor 2 alpha) - transmembrane and ubiquitin-like domain containing 1 |