Login to display prices
Login to display prices
PHLDA3-pleckstrin homology-like domain, family A, member 3 Gene View larger

PHLDA3-pleckstrin homology-like domain, family A, member 3 Gene

PTXBC014390

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PHLDA3-pleckstrin homology-like domain, family A, member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PHLDA3-pleckstrin homology-like domain, family A, member 3 Gene

Proteogenix catalog: PTXBC014390
Ncbi symbol: PHLDA3
Product name: PHLDA3-pleckstrin homology-like domain, family A, member 3 Gene
Size: 2ug
Accessions: BC014390
Gene id: 23612
Gene description: pleckstrin homology-like domain, family A, member 3
Synonyms: TIH1; pleckstrin homology-like domain family A member 3; TDAG51/Ipl homolog 1; pleckstrin homology-like domain, family A, member 2; pleckstrin homology like domain family A member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacggcggcggcgacggctaccgtgctcaaggagggcgtgctggagaagcgcagcggcgggctgctgcagctgtggaagcggaagcgctgcgtcctcaccgaacgcgggctgcagctcttcgaggccaagggcacgggcggccggcccaaggagctcagcttcgcccgcatcaaggccgtggagtgcgtggagagcaccgggcgccacatctacttcacgctggtgaccgaagggggcggcgagatcgacttccgctgccccctggaagatcccggctggaacgcccagatcaccctaggcctggtcaagttcaagaaccagcaggccatccagacagtgcgggcccggcagagcctcgggaccgggaccctcgtgtcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: