Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TMUB1-transmembrane and ubiquitin-like domain containing 1 Gene
PTXBC000936
New product
Data sheet of TMUB1-transmembrane and ubiquitin-like domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMUB1-transmembrane and ubiquitin-like domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000936 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMUB1 |
| Origin species: | Human |
| Product name: | TMUB1-transmembrane and ubiquitin-like domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC000936 |
| Gene id: | 83590 |
| Gene description: | transmembrane and ubiquitin-like domain containing 1 |
| Synonyms: | C7orf21; DULP; SB144; transmembrane and ubiquitin-like domain-containing protein 1; dendritic cell-derived ubiquitin-like protein; hepatocyte odd protein shuttling protein; ubiquitin-like protein DULP; ubiquitin-like protein SB144; transmembrane and ubiquitin like domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccctgattgaaggggtgggtgatgaggtgaccgtccttttctcggtgcttgcctgccttctggtgctggcccttgcctgggtctcaacgcacaccgctgagggcggggacccactgccccagccgtcagggaccccaacgccatcccagcccagcgcagccatggcagctaccgacagcatgagaggggaggccccaggggcagagacccccagcctgagacacagaggtcaagctgcacagccagagcccagcacggggttcacagcaacaccgccagccccggactccccgcaggagcccctcgtgctacggctgaaattcctcaatgattcagagcaggtggccagggcctggccccacgacaccattggctccttgaaaaggacccagtttcccggccgggaacagcaggtgcgactcatctaccaagggcagctgctaggcgacgacacccagaccctgggcagccttcacctccctcccaactgcgttctccactgccacgtgtccacgagagtcggtcccccaaatcccccctgcccgccggggtccgagcccggcccctccgggctggaaatcggcagcctgctgctgcccctgctgctcctgctgttgctgctgctctggtactgccagatccagtaccggcccttctttcccctgaccgccactctgggcctggccggcttcaccctgctcctcagtctcctggcctttgccatgtaccgcccgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology-like domain, family A, member 1 - proteasome (prosome, macropain) assembly chaperone 2 - membrane-spanning 4-domains, subfamily A, member 12 - coiled-coil domain containing 5 (spindle associated) |