CCDC5-coiled-coil domain containing 5 (spindle associated) Gene View larger

CCDC5-coiled-coil domain containing 5 (spindle associated) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC5-coiled-coil domain containing 5 (spindle associated) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC5-coiled-coil domain containing 5 (spindle associated) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014003
Product type: DNA & cDNA
Ncbi symbol: CCDC5
Origin species: Human
Product name: CCDC5-coiled-coil domain containing 5 (spindle associated) Gene
Size: 2ug
Accessions: BC014003
Gene id: 115106
Gene description: coiled-coil domain containing 5 (spindle associated)
Synonyms: CCDC5; HEI-C; HEIC; HsT1461; HAUS augmin-like complex subunit 1; coiled-coil domain containing 5 (spindle associated); coiled-coil domain-containing protein 5; enhancer of invasion-cluster; HAUS augmin like complex subunit 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccgcaggaggagagagaaacgcaggttgctgcgtggttaaaaaaaatatttggagatcatcctattccacagtatgaggtgaacccacggaccacagagattttacatcacctttcagaacgcaacagggtccgggacagggatgtctacctggtaatagaggacttgaagcagaaagcaagtgaatacgagtcagaagccaagtatcttcaagaccttctcatggagagtgtgaatttttcccccgccaatctctctagcactggttccaggtatctgaatgctttggttgacagtgcggtggcccttgaaacaaaggatacctcgctagctagttttatccctgcagtgaatgatttgacctctgatctctttcgtaccaaatccaaaagtgaagaaatcaagattgaactggaaaaacttgaaaaaaatttaactgcaactttagtattagaaaaatgtctacaagaggatgtcaagaaagcagagttgcatctgtctacagaaagggccaaagttgataatcgtcgtcagaacatggactttctaaaagcaaagtcagaggaattcagatttggaatcaaggctgcagaggagcaactttcagccagaggcatggatgcttctctgtctcatcagtccttagtagcactatcagagaaactggcaagattaaagcaacagactatacctttgaagaaaaaattggagtcctatttagacttaatgccgaatccgtctcttgctcaagtgaaaattgaagaagcaaagcgagaactagatagcattgaagctgaacttacaagaagagtagacatgatggaactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phenazine biosynthesis-like protein domain containing
- solute carrier family 7, member 6 opposite strand
- SH3 domain containing, Ysc84-like 1 (S. cerevisiae)
- calcium channel, voltage-dependent, gamma subunit 4

Buy CCDC5-coiled-coil domain containing 5 (spindle associated) Gene now

Add to cart