Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CACNG4-calcium channel, voltage-dependent, gamma subunit 4 Gene
PTXBC034532
New product
Data sheet of CACNG4-calcium channel, voltage-dependent, gamma subunit 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CACNG4-calcium channel, voltage-dependent, gamma subunit 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034532 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CACNG4 |
| Origin species: | Human |
| Product name: | CACNG4-calcium channel, voltage-dependent, gamma subunit 4 Gene |
| Size: | 2ug |
| Accessions: | BC034532 |
| Gene id: | 27092 |
| Gene description: | calcium channel, voltage-dependent, gamma subunit 4 |
| Synonyms: | voltage-dependent calcium channel gamma-4 subunit; TARP gamma-4; calcium channel, voltage-dependent, gamma subunit 4; neuronal voltage-gated calcium channel gamma-4 subunit; transmembrane AMPAR regulatory protein gamma-4; calcium voltage-gated channel auxiliary subunit gamma 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgcgatgcgaccgcgggctgcagatgctgctgaccacggccggagccttcgccgccttctcgctcatggccatcgccatcggcaccgactactggctgtactccagcgcgcacatctgcaacggcaccaacctgaccatggacgacgggcccccgccccgccgcgcccgcggcgacctcacccactctggtctgtggcgggtgtgctgcatcgaagggatctataaagggcactgcttccggatcaatcacttcccagaggacaatgactacgaccacgacagctcggagtacctcctccgcatcgtgcgagcctccagcgtcttccccatcctcagcaccatcctgctcctgctgggtggcctgtgcatcggtgctggcaggatctacagccgcaagaacaacatcgtcctcagtgccggcatcctcttcgtggctgcaggcctcagtaacatcatcggtatcatcgtctacatttccagcaacacaggtgacccgagtgacaagcgggacgaagacaaaaagaaccattacaactacggctggtctttttactttggagctctgtctttcattgtggctgagaccgtgggcgtcctggctgtaaacatttacattgagaaaaataaagagttgaggtttaagaccaaacgggaattccttaaggcgtcttcctcttctccttatgccaggatgccgagctacaggtaccggcgacggcgctcgaggtccagctcaaggtccactgaggcctcgccctccagggacgtgtcgcccatgggcctgaagatcacaggggccatccccatgggggagctgtccatgtacacgctgtccagggagcccctcaaggtgaccaccgcagccagctacagccccgaccaggaggccagcttcctgcaggtgcatgactttttccagcaggacctgaaggaaggtttccacgtcagcatgctgaaccgacggacgacccctgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ST3 beta-galactoside alpha-2,3-sialyltransferase 6 - ST3 beta-galactoside alpha-2,3-sialyltransferase 4 - SH3 domain containing, Ysc84-like 1 (S. cerevisiae) - hypoxia inducible factor 1, alpha subunit inhibitor |