CACNG4-calcium channel, voltage-dependent, gamma subunit 4 Gene View larger

CACNG4-calcium channel, voltage-dependent, gamma subunit 4 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CACNG4-calcium channel, voltage-dependent, gamma subunit 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CACNG4-calcium channel, voltage-dependent, gamma subunit 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034532
Product type: DNA & cDNA
Ncbi symbol: CACNG4
Origin species: Human
Product name: CACNG4-calcium channel, voltage-dependent, gamma subunit 4 Gene
Size: 2ug
Accessions: BC034532
Gene id: 27092
Gene description: calcium channel, voltage-dependent, gamma subunit 4
Synonyms: voltage-dependent calcium channel gamma-4 subunit; TARP gamma-4; calcium channel, voltage-dependent, gamma subunit 4; neuronal voltage-gated calcium channel gamma-4 subunit; transmembrane AMPAR regulatory protein gamma-4; calcium voltage-gated channel auxiliary subunit gamma 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcgatgcgaccgcgggctgcagatgctgctgaccacggccggagccttcgccgccttctcgctcatggccatcgccatcggcaccgactactggctgtactccagcgcgcacatctgcaacggcaccaacctgaccatggacgacgggcccccgccccgccgcgcccgcggcgacctcacccactctggtctgtggcgggtgtgctgcatcgaagggatctataaagggcactgcttccggatcaatcacttcccagaggacaatgactacgaccacgacagctcggagtacctcctccgcatcgtgcgagcctccagcgtcttccccatcctcagcaccatcctgctcctgctgggtggcctgtgcatcggtgctggcaggatctacagccgcaagaacaacatcgtcctcagtgccggcatcctcttcgtggctgcaggcctcagtaacatcatcggtatcatcgtctacatttccagcaacacaggtgacccgagtgacaagcgggacgaagacaaaaagaaccattacaactacggctggtctttttactttggagctctgtctttcattgtggctgagaccgtgggcgtcctggctgtaaacatttacattgagaaaaataaagagttgaggtttaagaccaaacgggaattccttaaggcgtcttcctcttctccttatgccaggatgccgagctacaggtaccggcgacggcgctcgaggtccagctcaaggtccactgaggcctcgccctccagggacgtgtcgcccatgggcctgaagatcacaggggccatccccatgggggagctgtccatgtacacgctgtccagggagcccctcaaggtgaccaccgcagccagctacagccccgaccaggaggccagcttcctgcaggtgcatgactttttccagcaggacctgaaggaaggtttccacgtcagcatgctgaaccgacggacgacccctgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ST3 beta-galactoside alpha-2,3-sialyltransferase 6
- ST3 beta-galactoside alpha-2,3-sialyltransferase 4
- SH3 domain containing, Ysc84-like 1 (S. cerevisiae)
- hypoxia inducible factor 1, alpha subunit inhibitor

Buy CACNG4-calcium channel, voltage-dependent, gamma subunit 4 Gene now

Add to cart