Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HIF1AN-hypoxia inducible factor 1, alpha subunit inhibitor Gene
PTXBC007719
New product
Data sheet of HIF1AN-hypoxia inducible factor 1, alpha subunit inhibitor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIF1AN-hypoxia inducible factor 1, alpha subunit inhibitor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007719 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIF1AN |
| Origin species: | Human |
| Product name: | HIF1AN-hypoxia inducible factor 1, alpha subunit inhibitor Gene |
| Size: | 2ug |
| Accessions: | BC007719 |
| Gene id: | 55662 |
| Gene description: | hypoxia inducible factor 1, alpha subunit inhibitor |
| Synonyms: | FIH1; hypoxia-inducible factor 1-alpha inhibitor; FIH-1; factor inhibiting HIF-1; factor inhibiting HIF1; hypoxia-inducible factor asparagine hydroxylase; peptide-aspartate beta-dioxygenase; hypoxia inducible factor 1 alpha subunit inhibitor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgacagcggcggaggctgtggcctctggctctggagagccccgggaggaggctggagccctcggccccgcctgggatgaatcccagttgcgcagttatagcttcccgactaggcccattccgcgtctgagtcagagcgacccccgggcagaggagcttattgagaatgaggagcctgtggtgctgaccgacacaaatcttgtgtatcctgccctgaaatgggaccttgaatacctgcaagagaatattggcaatggagacttctctgtgtacagtgccagcacccacaagttcttgtactatgatgagaagaagatggccaatttccagaactttaagccgaggtccaacagggaagaaatgaaatttcatgagttcgttgagaaactgcaggatatacagcagcgaggaggggaagagaggttgtatctgcagcaaacgctcaatgacactgtgggcaggaagattgtcatggacttcttaggttttaactggaactggattaataagcaacagggaaagcgtggctgggggcagcttacctctaacctgctgctcattggcatggaaggaaatgtgacacctgctcactatgatgagcagcagaacttttttgctcagataaaaggttacaaacgatgcatcttattccctccggatcagttcgagtgcctctacccataccctgttcatcacccatgtgacagacagagccaggtggactttgacaatcccgactacgagaggttccctaatttccaaaatgtggttggttacgaaacagtggttggccctggtgatgttctttacatcccaatgtactggtggcatcacatagagtcattactaaatggggggattaccatcactgtgaacttctggtataagggggctcccacccctaagagaattgaatatcctctcaaagctcatcagaaagtggccataatgagaaacattgagaagatgcttggagaggccttggggaacccacaagaggtggggcccttgttgaacacaatgatcaagggccgatacaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ST3 beta-galactoside alpha-2,3-sialyltransferase 2 - dynein, cytoplasmic 2, light intermediate chain 1 - fucosyltransferase 9 (alpha (1,3) fucosyltransferase) - translocation associated membrane protein 1-like 1 |