Login to display prices
Login to display prices
FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene View larger

FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene

PTXBC036101

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene

Proteogenix catalog: PTXBC036101
Ncbi symbol: FUT9
Product name: FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene
Size: 2ug
Accessions: BC036101
Gene id: 10690
Gene description: fucosyltransferase 9 (alpha (1,3) fucosyltransferase)
Synonyms: Fuc-TIX; alpha-(1,3)-fucosyltransferase 9; fucT-IX; fucosyltransferase 9 (alpha (1,3) fucosyltransferase); fucosyltransferase IX; galactoside 3-L-fucosyltransferase; fucosyltransferase 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacatcaacatccaaaggaattcttcgcccatttttgattgtctgcattatcctgggctgtttcatggcatgtcttctcatttacatcaaacctaccaacagctggatcttcagtccaatggaatcagccagctctgtgctgaaaatgaaaaacttcttttccaccaaaactgattattttaatgaaactactattctggtgtgggtgtggccatttgggcagacctttgaccttacatcctgccaagcaatgttcaacatccaaggatgccatctcacaacggaccgttcactgtacaacaaatcccatgcagttctgatccatcaccgagacatcagttgggatctgacaaatttacctcagcaagctaggccacccttccagaaatggatttggatgaatttggaatcaccaactcacactccccaaaagagtggcattgagcacttgtttaacctgactctgacttaccgccgtgattcagatatccaagtgccttatggcttcttgacggtaagcacaaatcccttcgtgtttgaagtgccaagcaaagagaaattggtgtgctgggttgtgagtaactggaaccctgagcatgccagagtcaagtattacaatgagctaagcaaaagcattgaaatccatacctacgggcaagcatttggagaatatgtcaatgataaaaatttgattcctaccatatctgcttgtaaattttatctttcctttgaaaattcaatccacaaggattacatcacggaaaagctatacaatgcttttctggctggctctgtacctgttgttctgggaccatctagggaaaactatgagaattatattccagcagattcattcattcatgtggaagattataactctcccagtgagctagcaaagtatctgaaggaagtcgacaaaaacaataagttataccttagttactttaactggaggaaggatttcactgtaaatcttccacgattttgggaatcacatgcatgtttggcttgcgatcatgtgaaaaggcatcaagaatataagtctgttggtaatttagagaaatggttttggaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: