Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene
PTXBC036101
New product
Data sheet of FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036101 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FUT9 |
| Origin species: | Human |
| Product name: | FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene |
| Size: | 2ug |
| Accessions: | BC036101 |
| Gene id: | 10690 |
| Gene description: | fucosyltransferase 9 (alpha (1,3) fucosyltransferase) |
| Synonyms: | Fuc-TIX; alpha-(1,3)-fucosyltransferase 9; fucT-IX; fucosyltransferase 9 (alpha (1,3) fucosyltransferase); fucosyltransferase IX; galactoside 3-L-fucosyltransferase; fucosyltransferase 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacatcaacatccaaaggaattcttcgcccatttttgattgtctgcattatcctgggctgtttcatggcatgtcttctcatttacatcaaacctaccaacagctggatcttcagtccaatggaatcagccagctctgtgctgaaaatgaaaaacttcttttccaccaaaactgattattttaatgaaactactattctggtgtgggtgtggccatttgggcagacctttgaccttacatcctgccaagcaatgttcaacatccaaggatgccatctcacaacggaccgttcactgtacaacaaatcccatgcagttctgatccatcaccgagacatcagttgggatctgacaaatttacctcagcaagctaggccacccttccagaaatggatttggatgaatttggaatcaccaactcacactccccaaaagagtggcattgagcacttgtttaacctgactctgacttaccgccgtgattcagatatccaagtgccttatggcttcttgacggtaagcacaaatcccttcgtgtttgaagtgccaagcaaagagaaattggtgtgctgggttgtgagtaactggaaccctgagcatgccagagtcaagtattacaatgagctaagcaaaagcattgaaatccatacctacgggcaagcatttggagaatatgtcaatgataaaaatttgattcctaccatatctgcttgtaaattttatctttcctttgaaaattcaatccacaaggattacatcacggaaaagctatacaatgcttttctggctggctctgtacctgttgttctgggaccatctagggaaaactatgagaattatattccagcagattcattcattcatgtggaagattataactctcccagtgagctagcaaagtatctgaaggaagtcgacaaaaacaataagttataccttagttactttaactggaggaaggatttcactgtaaatcttccacgattttgggaatcacatgcatgtttggcttgcgatcatgtgaaaaggcatcaagaatataagtctgttggtaatttagagaaatggttttggaattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translocation associated membrane protein 1-like 1 - aryl hydrocarbon receptor interacting protein-like 1 - N-acylsphingosine amidohydrolase (acid ceramidase) 1 - queuine tRNA-ribosyltransferase domain containing 1 |