FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene View larger

FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene

PTXBC036101

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036101
Product type: DNA & cDNA
Ncbi symbol: FUT9
Origin species: Human
Product name: FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene
Size: 2ug
Accessions: BC036101
Gene id: 10690
Gene description: fucosyltransferase 9 (alpha (1,3) fucosyltransferase)
Synonyms: Fuc-TIX; alpha-(1,3)-fucosyltransferase 9; fucT-IX; fucosyltransferase 9 (alpha (1,3) fucosyltransferase); fucosyltransferase IX; galactoside 3-L-fucosyltransferase; fucosyltransferase 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacatcaacatccaaaggaattcttcgcccatttttgattgtctgcattatcctgggctgtttcatggcatgtcttctcatttacatcaaacctaccaacagctggatcttcagtccaatggaatcagccagctctgtgctgaaaatgaaaaacttcttttccaccaaaactgattattttaatgaaactactattctggtgtgggtgtggccatttgggcagacctttgaccttacatcctgccaagcaatgttcaacatccaaggatgccatctcacaacggaccgttcactgtacaacaaatcccatgcagttctgatccatcaccgagacatcagttgggatctgacaaatttacctcagcaagctaggccacccttccagaaatggatttggatgaatttggaatcaccaactcacactccccaaaagagtggcattgagcacttgtttaacctgactctgacttaccgccgtgattcagatatccaagtgccttatggcttcttgacggtaagcacaaatcccttcgtgtttgaagtgccaagcaaagagaaattggtgtgctgggttgtgagtaactggaaccctgagcatgccagagtcaagtattacaatgagctaagcaaaagcattgaaatccatacctacgggcaagcatttggagaatatgtcaatgataaaaatttgattcctaccatatctgcttgtaaattttatctttcctttgaaaattcaatccacaaggattacatcacggaaaagctatacaatgcttttctggctggctctgtacctgttgttctgggaccatctagggaaaactatgagaattatattccagcagattcattcattcatgtggaagattataactctcccagtgagctagcaaagtatctgaaggaagtcgacaaaaacaataagttataccttagttactttaactggaggaaggatttcactgtaaatcttccacgattttgggaatcacatgcatgtttggcttgcgatcatgtgaaaaggcatcaagaatataagtctgttggtaatttagagaaatggttttggaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - translocation associated membrane protein 1-like 1
- aryl hydrocarbon receptor interacting protein-like 1
- N-acylsphingosine amidohydrolase (acid ceramidase) 1
- queuine tRNA-ribosyltransferase domain containing 1

Buy FUT9-fucosyltransferase 9 (alpha (1,3) fucosyltransferase) Gene now

Add to cart