ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene View larger

ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016481
Product type: DNA & cDNA
Ncbi symbol: ASAH1
Origin species: Human
Product name: ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene
Size: 2ug
Accessions: BC016481
Gene id: 427
Gene description: N-acylsphingosine amidohydrolase (acid ceramidase) 1
Synonyms: ACDase; ASAH; PHP; PHP32; SMAPME; acid ceramidase; N-acylsphingosine amidohydrolase (acid ceramidase) 1; acid CDase; acylsphingosine deacylase; N-acylsphingosine amidohydrolase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgggccggagttgcgtcgccttagtcctcctggctgccgccgtcagctgtgccgtcgcgcagcacgcgccgccgtggacagaggactgcagaaaatcaacctatcctccttcaggaccaacgtacagaggtgcagttccatggtacaccataaatcttgacttaccaccctacaaaagatggcatgaattgatgcttgacaaggcaccaatgctaaaggttatagtgaattctctgaagaatatgataaatacattcgtgccaagtggaaaagttatgcaggtggtggatgaaaaattgcctggcctacttggcaactttcctggcccttttgaagaggaaatgaagggtattgccgctgttactgatatacctttaggagagattatttcattcaatattttttatgaattatttaccatttgtacttcaatagtagcagaagacaaaaaaggtcatctaatacatgggagaaacatggattttggagtatttcttgggtggaacataaataatgatacctgggtcataactgagcaactaaaacctttaacagtgaatttggatttccaaagaaacaacaaaactgtcttcaaggcttcaagctttgctggctatgtgggcatgttaacaggattcaaaccaggactgttcagtcttacactgaatgaacgtttcagtataaatggtggttatctgggtattctagaatggattctgggaaagaaagatgccatgtggatagggttcctcactagaacagttctggaaaatagcacaagttatgaagaagccaagaatttattgaccaagaccaagatattggccccagcctactttatcctgggaggcaaccagtctggggaaggttgtgtgattacacgagacagaaaggaatcattggatgtatatgaactcgatgctaagcagggtagatggtatgtggtacaaacaaattatgaccgttggaaacatcccttcttccttgatgatcgcagaacgcctgcaaagatgtgtctgaaccgcaccagccaagagaatatctcatttgaaaccatgtatgatgtcctgtcaacaaaacctgtcctcaacaagctgaccgtatacacaaccttgatagatgttaccaaaggtcaattcgaaacttacctgcgggactgccctgacccttgtataggttggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - queuine tRNA-ribosyltransferase domain containing 1
- acyl-Coenzyme A dehydrogenase, short/branched chain
- golgi associated PDZ and coiled-coil motif containing
- early growth response 2 (Krox-20 homolog, Drosophila)

Buy ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene now

Add to cart