Login to display prices
Login to display prices
ACADSB-acyl-Coenzyme A dehydrogenase, short/branched chain Gene View larger

ACADSB-acyl-Coenzyme A dehydrogenase, short/branched chain Gene

PTXBC013756

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACADSB-acyl-Coenzyme A dehydrogenase, short/branched chain Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACADSB-acyl-Coenzyme A dehydrogenase, short/branched chain Gene

Proteogenix catalog: PTXBC013756
Ncbi symbol: ACADSB
Product name: ACADSB-acyl-Coenzyme A dehydrogenase, short/branched chain Gene
Size: 2ug
Accessions: BC013756
Gene id: 36
Gene description: acyl-Coenzyme A dehydrogenase, short/branched chain
Synonyms: 2-MEBCAD; ACAD7; SBCAD; short/branched chain specific acyl-CoA dehydrogenase, mitochondrial; 2-methyl branched chain acyl-CoA dehydrogenase; 2-methylbutyryl-coenzyme A dehydrogenase; acyl-Coenzyme A dehydrogenase, short/branched chain; acyl-CoA dehydrogenase, short/branched chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagggcctggcagtgcggttgctgcgcggcagcaagctgctaagaagaaatttcctgacttgtttgtcttcttggaagattcctcctcatgtctcaaaatcttcccagtcagaagctctactcaatataacaaataatggaatacactttgctcccctgcaaacatttacagatgaggaaatgatgataaagagttcagttaaaaaatttgctcaggaacaaattgcacctttggtttcaaccatggatgaaaattcgaaaatggagaaatcagtaatacaaggattatttcaacaagggttgatgggtattgaagttgacccagaatatggaggcacaggagcttcatttttatccactgtgctcgtgatagaggaattagccaaagttgatgcatctgtggctgtcttttgtgagatccagaacacattaattaacacactgattagaaaacatggaacagaagaacaaaaggccacctatttgcctcagctcactacagaaaaagtaggaagtttctgcctttcagaggctggagcaggtagtgactcatttgctttgaagaccagagctgataaagagggagattattatgtcctcaatggatcaaagatgtggatcagcagtgctgagcacgcagggctctttctggtgatggcaaatgtagaccctaccattggatataagggaattacctccttcttagtagatcgtgatactccgggccttcatatagggaaacctgaaaacaaattggggctcagagcttcttccacctgcccgttaacattcgaaaatgtcaaggttccagaagccaatatcttgggacaaattggacatggctataagtatgccatagggagtctcaatgaaggtagaataggaattgctgcacagatgctgggactggcgcaaggatgttttgactacactattccatatattaaagaaaggatacaatttggcaaaagactatttgattttcagggcctccaacaccaagtggctcacgtggccacccagctggaagctgcaagattactaacatacaatgctgctaggcttttagaagctggaaagccattcataaaagaagcgtcaatggccaaatactatgcatcagagattgcaggacaaacaacgagtaaatgtatcgagtggatggggggagtaggctacaccaaagattaccctgtggagaaatacttccgagatgcaaagattggtacgatatatgaaggagcttccaacatccagttgaacaccattgcaaagcatatcgatgcagaatactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: