ACADSB-acyl-Coenzyme A dehydrogenase, short/branched chain Gene View larger

ACADSB-acyl-Coenzyme A dehydrogenase, short/branched chain Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACADSB-acyl-Coenzyme A dehydrogenase, short/branched chain Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACADSB-acyl-Coenzyme A dehydrogenase, short/branched chain Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013756
Product type: DNA & cDNA
Ncbi symbol: ACADSB
Origin species: Human
Product name: ACADSB-acyl-Coenzyme A dehydrogenase, short/branched chain Gene
Size: 2ug
Accessions: BC013756
Gene id: 36
Gene description: acyl-Coenzyme A dehydrogenase, short/branched chain
Synonyms: 2-MEBCAD; ACAD7; SBCAD; short/branched chain specific acyl-CoA dehydrogenase, mitochondrial; 2-methyl branched chain acyl-CoA dehydrogenase; 2-methylbutyryl-coenzyme A dehydrogenase; acyl-Coenzyme A dehydrogenase, short/branched chain; acyl-CoA dehydrogenase, short/branched chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagggcctggcagtgcggttgctgcgcggcagcaagctgctaagaagaaatttcctgacttgtttgtcttcttggaagattcctcctcatgtctcaaaatcttcccagtcagaagctctactcaatataacaaataatggaatacactttgctcccctgcaaacatttacagatgaggaaatgatgataaagagttcagttaaaaaatttgctcaggaacaaattgcacctttggtttcaaccatggatgaaaattcgaaaatggagaaatcagtaatacaaggattatttcaacaagggttgatgggtattgaagttgacccagaatatggaggcacaggagcttcatttttatccactgtgctcgtgatagaggaattagccaaagttgatgcatctgtggctgtcttttgtgagatccagaacacattaattaacacactgattagaaaacatggaacagaagaacaaaaggccacctatttgcctcagctcactacagaaaaagtaggaagtttctgcctttcagaggctggagcaggtagtgactcatttgctttgaagaccagagctgataaagagggagattattatgtcctcaatggatcaaagatgtggatcagcagtgctgagcacgcagggctctttctggtgatggcaaatgtagaccctaccattggatataagggaattacctccttcttagtagatcgtgatactccgggccttcatatagggaaacctgaaaacaaattggggctcagagcttcttccacctgcccgttaacattcgaaaatgtcaaggttccagaagccaatatcttgggacaaattggacatggctataagtatgccatagggagtctcaatgaaggtagaataggaattgctgcacagatgctgggactggcgcaaggatgttttgactacactattccatatattaaagaaaggatacaatttggcaaaagactatttgattttcagggcctccaacaccaagtggctcacgtggccacccagctggaagctgcaagattactaacatacaatgctgctaggcttttagaagctggaaagccattcataaaagaagcgtcaatggccaaatactatgcatcagagattgcaggacaaacaacgagtaaatgtatcgagtggatggggggagtaggctacaccaaagattaccctgtggagaaatacttccgagatgcaaagattggtacgatatatgaaggagcttccaacatccagttgaacaccattgcaaagcatatcgatgcagaatactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - golgi associated PDZ and coiled-coil motif containing
- early growth response 2 (Krox-20 homolog, Drosophila)
- calcium/calmodulin-dependent protein kinase II beta
- metal response element binding transcription factor 2

Buy ACADSB-acyl-Coenzyme A dehydrogenase, short/branched chain Gene now

Add to cart