Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GOPC-golgi associated PDZ and coiled-coil motif containing Gene
PTXBC009553
New product
Data sheet of GOPC-golgi associated PDZ and coiled-coil motif containing Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GOPC-golgi associated PDZ and coiled-coil motif containing Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009553 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GOPC |
| Origin species: | Human |
| Product name: | GOPC-golgi associated PDZ and coiled-coil motif containing Gene |
| Size: | 2ug |
| Accessions: | BC009553 |
| Gene id: | 57120 |
| Gene description: | golgi associated PDZ and coiled-coil motif containing |
| Synonyms: | CAL; FIG; GOPC1; PIST; dJ94G16.2; Golgi-associated PDZ and coiled-coil motif-containing protein; CFTR-associated ligand; PDZ protein interacting specifically with TC10; PDZ/coiled-coil domain binding partner for the rho-family GTPase TC10; dJ94G16.2 PIST; fused in glioblastoma; golgi-associated PDZ and coiled-coil motif containing protein; golgi associated PDZ and coiled-coil motif containing |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggcgggcggtccatgcccagcagcagccggagggggcccagggggcgcctcctgctccgtgggggcccctggcggggtatccatgttccggtggctggaggtgctggagaaggagttcgacaaagcttttgtggatgtggatctgctcctgggagagatcgatccagaccaagcggacatcacttatgaggggcgacagaagatgaccagcctgagctcctgctttgcacagctttgccacaaagcccagtctgtgtctcaaatcaaccacaagctggaggcacagttggtggatctgaaatctgaactgacagaaacccaagcagagaaagttgttttggagaaagaagtacatgatcagcttttacagctgcactctattcagctgcagcttcatgctaaaactggtcaaagtgctgactctggtaccattaaggcaaaattggaaagagagcttgaggcaaacaaaaaagaaaaaatgaaagaagcacaacttgaagctgaagtgaaattgttgagaaaagagaatgaagcccttcgtagacatatagctgttctccaggctgaagtatatggggcgagactagctgccaagtacttggataaggaactggcaggaagggtccaacagatacaattgctaggacgagatatgaagggacctgctcatgataagctttggaaccaattagaagctgaaatacatttgcatcgtcacaaaactgtgatccgagcctgcagaggacgtaatgacttgaaacgaccaatgcaagcaccaccaggccatgatcaagattccctaaagaaaagccaaggtgttggtccaattagaaaagttctcctccttaaggaagatcatgaaggccttggcatttcaattacaggtgggaaagaacatggtgttccaatcctcatctctgagatccatccggggcaacctgctgatagatgcggagggctgcacgttggggatgctattttggcagtcaacggagttaacctaagggacacaaagcataaagaagctgtaactattctttctcagcagagaggagagattgaatttgaagtagtttatgtggctcctgaagtggattctgatgatgaaaacgtagagtatgaagatgagagtggacatcgttaccgtttgtaccttgatgagttagaaggaggtggtaaccctggtgctagttgcaaagacacaagtggggaaatcaaagtattacaaggatttaataagaaggcagtaactgacacacatgaaaatggagacctgggcactgcaagtgaaactccgctagatgacggtgcttcaaaattagatgatctgcacactctgtatcataaaaaatcttattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - early growth response 2 (Krox-20 homolog, Drosophila) - calcium/calmodulin-dependent protein kinase II beta - metal response element binding transcription factor 2 - essential meiotic endonuclease 1 homolog 1 (S. pombe) |