EME1-essential meiotic endonuclease 1 homolog 1 (S. pombe) Gene View larger

EME1-essential meiotic endonuclease 1 homolog 1 (S. pombe) Gene

PTXBC016470

New product

Data sheet of EME1-essential meiotic endonuclease 1 homolog 1 (S. pombe) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EME1-essential meiotic endonuclease 1 homolog 1 (S. pombe) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC016470
Product type: DNA & cDNA
Ncbi symbol: EME1
Origin species: Human
Product name: EME1-essential meiotic endonuclease 1 homolog 1 (S. pombe) Gene
Size: 2ug
Accessions: BC016470
Gene id: 146956
Gene description: essential meiotic endonuclease 1 homolog 1 (S. pombe)
Synonyms: homolog of yeast EME1 endonuclease; crossover junction endonuclease EME1; MMS4L; SLX2A; MMS4 homolog; SLX2 structure-specific endonuclease subunit homolog A; essential meiotic endonuclease 1 homolog 1; essential meiotic endonuclease 1 homolog 2; hMMS4; essential meiotic structure-specific endonuclease 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctctaaagaagtcatcaccctcactggattctggtgatagtgactctgaggagttgccaacatttgcctttctgaagaaggaaccatcttcaacaaagaggagacagcctgaaagggaagagaagattgtagtggttgacatctcagattgtgaagcctcctgtcctccagcaccagagttattttcaccacctgtcccagacatagctgaaactgtcacacaaacacagccagtcaggttgctaagcagtgaaagtgaagatgaagaagaatttattcctctggctcaaaggcttacatgtaagtttctgacccacaagcaactgagccctgaggactctagctccccagttaaaagtgttttggatcatcaaaataatgaaggtgcatcatgtgactggaaaaagccctttccaaagatccctgaagttcccctccatgataccccagagaggagtgcagcagataacaaggacctgatcttagatccatgctgtcagcttccagcctacctgtctacctgccctggccagagcagcagcttggcagtaaccaaaacaaattctgacatccttccaccccagaagaaaaccaagccgagtcagaaggtccagggaagaggctcacacggatgccggcagcagagacaagcaaggcagaaggaaagcaccctgagaagacaggaaagaaagaatgcagcactggttaccaggatgaaagcccagaggccagaggaatgcttaaaacacatcattgtagtgctggatccagtgctcttacagatggaaggtgggggccagctcctaggagcactgcagaccatggagtgccgctgtgtgattgaggcgcaggctgtgccttgcagtgtcacttggaggagaagggctgggccgtctgaggacagagaggactgggtggaggagccaacagtactggtgttgctccgggcagaggcatttgtgtccatgatcgacaatggaaagcagggaagcctggacagcactatgaaagggaaggaaacgcttcagggctttgtaactgacatcacagcaaagacagcagggaaagctctgtcactggtgattgtggatcaggagaaatgcttcagcctggagctgctgttctttgatttcctcccctgcaccagtgctcagaatcctccaagaagagggaaacagggagcaaataaacagaccaagaagcagcagcagagacaaccagaggccagcatagggtccatggtatccagggtagacgctgaagaggcattggtggatctgcagctacacacagaagcccaggctcaaattgtgcagagctggaaagagctggccgacttcacatgcgcattcacaaaggctgtggctgaggcgcccttcaagaagctccgagatgaaactaccttctccttctgtctggagagtgactgggctggaggggtgaaggtggaccttgctggcaggggactcgcactagtctggaggagacagattcagcagctgaaccgagtcagcctggaaatggccagtgcagttgtgaatgcctatccctccccacagctcctggtacaggcttatcagcagtgtttttcggataaagaacgccagaatttgctcgcagacatacaggtgcgccgtggggaaggtgtgacatccacttctcgccgcattggaccagaactatccaggcgtatctaccttcagatgaccactttacagccacatctctctttagatagtgctgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - purinergic receptor P2X, ligand-gated ion channel, 7
- Janus kinase 3 (a protein tyrosine kinase, leukocyte)
- ATP-binding cassette, sub-family F (GCN20), member 3
- guanine nucleotide binding protein-like 2 (nucleolar)