Cart 12 Product Products 1 593,24 € (empty)
-
1 x PCLO-picco...113,40 € -
1 x PCID2-PCI...121,50 € -
1 x SS18-synov...121,50 € -
-
1 x FIP1L1-FIP...121,50 € -
1 x MTHFD2-met...121,50 € -
1 x FSCN1-fasc...121,50 € -
1 x MOS-v-mos...121,50 € -
1 x AGXT2L1-al...121,50 € -
-
1 x NDUFS4-NAD...113,40 € -
1 x SPINK6-ser...113,40 €
No products
To be determined Shipping
1 593,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 593,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 593,24 €
View larger 
JAK3-Janus kinase 3 (a protein tyrosine kinase, leukocyte) Gene
PTXBC028068
New product
Data sheet of JAK3-Janus kinase 3 (a protein tyrosine kinase, leukocyte) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about JAK3-Janus kinase 3 (a protein tyrosine kinase, leukocyte) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC028068 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | JAK3 |
| Origin species: | Human |
| Product name: | JAK3-Janus kinase 3 (a protein tyrosine kinase, leukocyte) Gene |
| Size: | 2ug |
| Accessions: | BC028068 |
| Gene id: | 3718 |
| Gene description: | Janus kinase 3 (a protein tyrosine kinase, leukocyte) |
| Synonyms: | tyrosine-protein kinase JAK3; JAK-3; JAK3_HUMAN; JAKL; L-JAK; LJAK; Janus kinase 3 (a protein tyrosine kinase, leukocyte); leukocyte Janus kinase; Janus kinase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcacctccaagtgaagagacgcccctgatccctcagcgttcatgcagcctcttgtccacggaggctggtgccctgcatgtgctgctgcccgctcggggccccgggcccccccagcgcctatctttctcctttggggaccacttggctgaggacctgtgcgtgcaggctgccaaggccagcggcatcctgcctgtgtaccactccctctttgctctggccacggaggacctgtcctgctggttccccccgagccacatcttctccgtggaggatgccagcacccaagtcctgctgtacaggattcgcttttacttccccaattggtttgggctggagaagtgccaccgcttcgggctacgcaaggatttggccagtgctatccttgacctgccagtcctggagcacctctttgcccagcaccgcagtgacctggtgagtgggcgcctccccgtgggcctcagtctcaaggagcagggtgagtgtctcagcctggccgtgttggacctggcccggatggcgcgagagcaggcccagcggccgggagagctgctgaagactgtcagctacaaggcctgcctacccccaagcctgcgcgacctgatccagggcctgagcttcgtgacgcggaggcgtattcggaggacggtgcgcagagccctgcgccgcgtggccgcctgccaggcagaccggcactcgctcatggccaagtacatcatggacctggagcggctggatccagccggggccgccgagaccttccacgtgggcctccctggggcccttggtggccacgacgggctggggctgctccgcgtggctggtgacggcggcatcgcctggacccagggagaacaggaggtcctccagcccttctgcgactttccagaaatcgtagacattagcatcaagcaggccccacgcgttggcccggccggagagcaccgcctggtcactgttaccaggacagacaaccagattttagaggccgagttcccagggctgcccgaggctctgtcgttcgtggcgctcgtggacggctacttccggctgaccacggactcccagcacttcttctgcaaggaggtggcaccgccgaggctgctggaggaagtggccgagcagtgccacggccccatcactctggactttgccatcaacaagctcaagactgggggctcacgtcctggctcctatgttctccgccgcagcccccaggactttgacagcttcctcctcactgtctgtgtccagaacccccttggtcctgattataagggctgcctcatccggcgcagccccacaggaaccttccttctggttggcctcagccgaccccacagcagtcttcgagagctcctggcaacctgctgggatggggggctgcacgtagatggggtggcagtgaccctcacttcctgctgtatccccagacccaaagaaaagtccaacctgatcgtggtccagagaggtcacagcccacccacatcatccttggttcagccccaatcccaataccagctgagtcagatgacatttcacaagatccctgctgacagcctggagtggcatgagaacctgggccatgggtccttcaccaagatttaccggggctgtcgccatgaggtggtggatggggaggcccgaaagacagaggtgctgctgaaggtcatggatgccaagcacaagaactgcatggagtcattcctggaagcagcgagcttgatgagccaagtgtcgtaccggcatctcgtgctgctccacggcgtgtgcatggctggagacagtgagagccccccacccacccaccccacccctgcctcacccaagtctaggctgttcttcccacctctgttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATP-binding cassette, sub-family F (GCN20), member 3 - guanine nucleotide binding protein-like 2 (nucleolar) - proteasome (prosome, macropain) assembly chaperone 3 - mesoderm induction early response 1, family member 2 |