TRAM1L1-translocation associated membrane protein 1-like 1 Gene View larger

TRAM1L1-translocation associated membrane protein 1-like 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRAM1L1-translocation associated membrane protein 1-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRAM1L1-translocation associated membrane protein 1-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030831
Product type: DNA & cDNA
Ncbi symbol: TRAM1L1
Origin species: Human
Product name: TRAM1L1-translocation associated membrane protein 1-like 1 Gene
Size: 2ug
Accessions: BC030831
Gene id: 133022
Gene description: translocation associated membrane protein 1-like 1
Synonyms: translocating chain-associated membrane protein 1-like 1; translocation associated membrane protein 1-like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctccgtaagaagagcaccaagaacccccccgttctcagccaggaattcatcctgcagaatcatgcggacatcgtctcctgcgtggggatgttcttcctgctggggcttgtgttcgagggaacagcagaagcatccatcgtgtttctcactcttcagcacagtgttgctgcccctgcagcagaggaacaagccacgggctcaaagtccctctattattatggtgtcaaagatttggccacggttttcttctacatgctggtggcaatcattattcatgccacaattcaggaatatgtgttggataaaattaacaagagaatgcagttcaccaaagcgaaacaaaacaagtttaacgagtctggtcagtttagtgtgttctactttttttcttgtatttggggcacattcattttaatctctgaaaactgcctgtcagacccaactcttatatggaaggctcgtccccatagcatgatgacatttcaaatgaagtttttctacatatcccagttggcttactggtttcatgcttttcctgaactctacttccagaaaaccaaaaaacaagacatccctcgtcaacttgtctacattggtcttcacctcttccacattactggagcttatctcttgtacttgaatcatttgggacttcttcttttggtactgcattattttgttgaattactttcccacatgtgcggcctgttttactttagtgatgagaagtaccagaaaggcatatctctgtgggccattgtgtttatcttgggtagacttgtgactttaattgtttccgtactcactgttgggtttcacctggctggatcgcagaatcggaatcctgatgcccttactggaaatgtaaatgtgttggcagctaaaattgctgttctgtcgtccagttgcacgatccaagcctacgtaacatggaacttaattactctctggcttcagaggtgggtagaagattctaatattcaggcctcatgtatgaaaaagaaacggtcgagatcttctaaaaaaagaacagaaaacggagtgggagtggaaacttcaaatagagtagactgtccgccaaagaggaaagagaaatcttcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aryl hydrocarbon receptor interacting protein-like 1
- N-acylsphingosine amidohydrolase (acid ceramidase) 1
- queuine tRNA-ribosyltransferase domain containing 1
- acyl-Coenzyme A dehydrogenase, short/branched chain

Buy TRAM1L1-translocation associated membrane protein 1-like 1 Gene now

Add to cart