ST3GAL4-ST3 beta-galactoside alpha-2,3-sialyltransferase 4 Gene View larger

ST3GAL4-ST3 beta-galactoside alpha-2,3-sialyltransferase 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ST3GAL4-ST3 beta-galactoside alpha-2,3-sialyltransferase 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ST3GAL4-ST3 beta-galactoside alpha-2,3-sialyltransferase 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010645
Product type: DNA & cDNA
Ncbi symbol: ST3GAL4
Origin species: Human
Product name: ST3GAL4-ST3 beta-galactoside alpha-2,3-sialyltransferase 4 Gene
Size: 2ug
Accessions: BC010645
Gene id: 6484
Gene description: ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Synonyms: CGS23; NANTA3; SAT3; SIAT4; SIAT4C; ST3GalIV; STZ; CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,3-sialyltransferase 4; SAT-3; SIAT4-C; ST-4; ST3GalA.2; alpha 2,3-ST 4; alpha 2,3-sialyltransferase IV; alpha-3-N-acetylneuraminyltransferase; beta-galactoside alpha-2,3-sialyltransferase 4; gal-NAc6S; gal-beta-1,4-GalNAc-alpha-2,3-sialyltransferase; sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase); sialyltransferase 4C (beta-galactoside alpha-2,3-sialytransferase); ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcagcaagtcccgctggaagctcctggccatgttggctctggtcctggtcgtcatggtgtggtattccatctcccgggaagacaggtacatcgagcttttttattttcccatcccagagaagaaggagccgtgcctccagggtgaggcagagagcaaggcctctaagctctttggcaactactcccgggatcagcccatcttcctgcggcttgaggattatttctgggtcaagacgccatctgcttacgagctgccctatgggaccaaggggagtgaggatctgctcctccgggtgctagccatcaccagctcctccatccccaagaacatccagagcctcaggtgccgccgctgtgtggtcgtggggaacgggcaccggctgcggaacagctcactgggagatgccatcaacaagtacgatgtggtcatcagattgaacaatgccccagtggctggctatgagggtgacgtgggctccaagaccaccatgcgtctcttctaccctgaatctgcccacttcgaccccaaagtagaaaacaacccagacacactcctcgtcctggtagctttcaaggcaatggacttccactggattgagaccatcctgagtgataagaagcgggtgcgaaagggtttctggaaacagcctcccctcatctgggatgtcaatcctaaacagattcggattctcaaccccttcttcatggagattgcagctgacaaactgctgagcctgccaatgcaacagccacggaagattaagcagaagcccaccacgggcctgttggccatcacgctggccctccacctctgtgacttggtgcacattgccggctttggctacccagacgcctacaacaagaagcagaccattcactactatgagcagatcacgctcaagtccatggcggggtcaggccataatgtctcccaagaggccctggccattaagcggatgctggagatgggagctatcaagaacctcacgtccttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SH3 domain containing, Ysc84-like 1 (S. cerevisiae)
- hypoxia inducible factor 1, alpha subunit inhibitor
- ST3 beta-galactoside alpha-2,3-sialyltransferase 2
- dynein, cytoplasmic 2, light intermediate chain 1

Buy ST3GAL4-ST3 beta-galactoside alpha-2,3-sialyltransferase 4 Gene now

Add to cart