Login to display prices
Login to display prices
ST3GAL6-ST3 beta-galactoside alpha-2,3-sialyltransferase 6 Gene View larger

ST3GAL6-ST3 beta-galactoside alpha-2,3-sialyltransferase 6 Gene

PTXBC023312

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ST3GAL6-ST3 beta-galactoside alpha-2,3-sialyltransferase 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ST3GAL6-ST3 beta-galactoside alpha-2,3-sialyltransferase 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC023312
Product type: DNA & cDNA
Ncbi symbol: ST3GAL6
Origin species: Human
Product name: ST3GAL6-ST3 beta-galactoside alpha-2,3-sialyltransferase 6 Gene
Size: 2ug
Accessions: BC023312
Gene id: 10402
Gene description: ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Synonyms: SIAT10; ST3GALVI; type 2 lactosamine alpha-2,3-sialyltransferase; CMP-NeuAc:beta-galactoside alpha-2,3-sialyltransferase VI; alpha2,3-sialyltransferase ST3Gal VI; sialyltransferase 10 (alpha-2,3-sialyltransferase VI); ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagagggtatcttgtggccatattcctgagtgctgtcttcctctattatgtactgcattgcatattatggggaacgaatgtctattgggtggcacctgtggaaatgaaacggagaaataagatccagccttgtttatcaaagccagcttttgcctctctgctgaggtttcatcagtttcacccttttctgtgtgcggctgattttagaaagattgcttccttgtatggtagcgataagtttgatttgccctatgggatgagaacatcagcggaatattttcgacttgctctttcaaaactgcagagttgtgatctctttgatgagtttgacaacataccctgtaaaaagtgtgtggtggttggtaatggaggagttttgaagaataagacattaggagaaaaaatcgactcctatgatgtaataataagaatgaataatggtcctgttttaggacatgaagaagaagttgggagaaggacaaccttccgacttttttatccagaatctgttttttcagatcctattcacaatgaccctaatacgacagtgattctcactgcttttaagccacatgatttaaggtggctgttggaattgttgatgggtgacaaaataaacactaatggtttttggaagaaaccagccttaaacctgatttataaaccttatcaaatccgaatattagatcctttcattatcagaacagcagcttatgaactgcttcattttccaaaagtgtttcccaaaaatcagaaacctaaacacccaacaacaggaattattgccatcacattggcgttttacatatgtcacgaagttcacctagctggttttaaatacaacttttctgacctcaagagtcctttgcactactatgggaatgccaccatgtctttgatgaataagaacgcgtatcacaatgtgactgcagagcagctctttttgaaggacattatagaaaaaaacctcgtaatcaacttgactcaagattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ST3 beta-galactoside alpha-2,3-sialyltransferase 4
- SH3 domain containing, Ysc84-like 1 (S. cerevisiae)
- hypoxia inducible factor 1, alpha subunit inhibitor
- ST3 beta-galactoside alpha-2,3-sialyltransferase 2