SLC7A6OS-solute carrier family 7, member 6 opposite strand Gene View larger

SLC7A6OS-solute carrier family 7, member 6 opposite strand Gene

PTXBC013778

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC7A6OS-solute carrier family 7, member 6 opposite strand Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC7A6OS-solute carrier family 7, member 6 opposite strand Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013778
Product type: DNA & cDNA
Ncbi symbol: SLC7A6OS
Origin species: Human
Product name: SLC7A6OS-solute carrier family 7, member 6 opposite strand Gene
Size: 2ug
Accessions: BC013778
Gene id: 84138
Gene description: solute carrier family 7, member 6 opposite strand
Synonyms: protein SLC7A6OS; ADAMS proteinase-related protein; solute carrier family 7 member 6 opposite strand transcript; solute carrier family 7 member 6 opposite strand
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccgccaggaccgctgtactccgggtgaagcggaagcgcagtgcggagccggcggaggctcttgtgctcgcttgtaaacgcctccggagcgacgcggtcgagtcagcggcacagaagacgtcggaggatttggagagagcggcggagaataatgtcttccacttggtggccactgtgtgctcccaggaggaaccagtccagcctctcctgcgggaagttctgcgcccgtcacgggacagccagcagcgtgtccgccgtaatctccgcgcctcggctcgggaggtccggcaggagggccgctaccgggtgctttccagccgccgatccttggggaccacctcgagcggccaggagtccgagtacacgccggggaacccagaagccgccgggaactcgggctttcagttgttagaccttgtccacgaggagggagaacctgaagccgcctctgcaggctcctgcaaaacatctgacccagatgtgatcctctgcaattctgtagagttgatccgtgagcgattgactgtgtctgaggatggaccaggagtcaggcgccaggaagaacaaaaacacgatgactatgtgtatgacatttactacttggagacggccactccaggctggattgagaacatcctctccgtgcagccctacagccaagaatgggagctggtgaatgatgatcaagaaccagaggacatttacgacgatgaagatgacgagaacagtgagaataactggcgcaatgagtacccagaggaggagagcagtgatggagatgaggattccagaggctctgctgactacaacagcctgagtgaggaggaaagaggcagcagcagacagcggatgtggagcaagtaccctctggatgtgcagaaggagttcggctatgacagcccccacgacctggattcagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SH3 domain containing, Ysc84-like 1 (S. cerevisiae)
- calcium channel, voltage-dependent, gamma subunit 4
- ST3 beta-galactoside alpha-2,3-sialyltransferase 6
- ST3 beta-galactoside alpha-2,3-sialyltransferase 4

Buy SLC7A6OS-solute carrier family 7, member 6 opposite strand Gene now

Add to cart