Login to display prices
Login to display prices
PBLD-phenazine biosynthesis-like protein domain containing Gene View larger

PBLD-phenazine biosynthesis-like protein domain containing Gene

PTXBC009738

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PBLD-phenazine biosynthesis-like protein domain containing Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PBLD-phenazine biosynthesis-like protein domain containing Gene

Proteogenix catalog: PTXBC009738
Ncbi symbol: PBLD
Product name: PBLD-phenazine biosynthesis-like protein domain containing Gene
Size: 2ug
Accessions: BC009738
Gene id: 64081
Gene description: phenazine biosynthesis-like protein domain containing
Synonyms: HEL-S-306; MAWBP; MAWDBP; phenazine biosynthesis-like domain-containing protein; MAWD-binding protein; epididymis secretory protein Li 306; phenazine biosynthesis like protein domain containing
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcttcctattttcatagcagatgcattcacagcaagagcatttcgtgggaatcctgctgctgtttgcctcctagaaaatgaattggatgaagacatgcatcagaaaattgcaagggagatgaacctctctgaaactgcttttatccgaaaactgcacccgacagacaactttgcacaaagttcctgctttggactgagatggtttacaccagcgagtgaggtcccactctgtggccatgccaccctggcttctgcagctgtgctgtttcacaaaataaaaaacatgaatagcacgctcacgtttgtcactctgagtggagaactaagggccagacgagcagaggacggcatcgtcctggacttgcctctttatccagcccacccccaggacttccatgaagtagaggacttgataaagactgccataggcaacacactggtccaggacatctgttattctccagatacccaaaagctcctcgtccgcctcagtgacgtttacaacaggtcgtttctggagaacctgaaagtgaacacggagaatctgctgcaagttgaaaacacagggaaggtgaaagggcttattcttacccttaaaggagagcctggtgggcagacccaagcatttgacttttactcaagatattttgcaccgtgggttggtgtggctgaagacccagtgacagggtctgcacacgctgttctcagcagctactggtcccagcatctggggaagaaagaaatgcatgcttttcagtgttcccaccgaggaggagagctgggaatttcccttcgtccagacggaagggttgacattagaggaggtgcagctgttgttttagagggcacactgacagcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: