PBLD-phenazine biosynthesis-like protein domain containing Gene View larger

PBLD-phenazine biosynthesis-like protein domain containing Gene

PTXBC009738

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PBLD-phenazine biosynthesis-like protein domain containing Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PBLD-phenazine biosynthesis-like protein domain containing Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009738
Product type: DNA & cDNA
Ncbi symbol: PBLD
Origin species: Human
Product name: PBLD-phenazine biosynthesis-like protein domain containing Gene
Size: 2ug
Accessions: BC009738
Gene id: 64081
Gene description: phenazine biosynthesis-like protein domain containing
Synonyms: HEL-S-306; MAWBP; MAWDBP; phenazine biosynthesis-like domain-containing protein; MAWD-binding protein; epididymis secretory protein Li 306; phenazine biosynthesis like protein domain containing
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcttcctattttcatagcagatgcattcacagcaagagcatttcgtgggaatcctgctgctgtttgcctcctagaaaatgaattggatgaagacatgcatcagaaaattgcaagggagatgaacctctctgaaactgcttttatccgaaaactgcacccgacagacaactttgcacaaagttcctgctttggactgagatggtttacaccagcgagtgaggtcccactctgtggccatgccaccctggcttctgcagctgtgctgtttcacaaaataaaaaacatgaatagcacgctcacgtttgtcactctgagtggagaactaagggccagacgagcagaggacggcatcgtcctggacttgcctctttatccagcccacccccaggacttccatgaagtagaggacttgataaagactgccataggcaacacactggtccaggacatctgttattctccagatacccaaaagctcctcgtccgcctcagtgacgtttacaacaggtcgtttctggagaacctgaaagtgaacacggagaatctgctgcaagttgaaaacacagggaaggtgaaagggcttattcttacccttaaaggagagcctggtgggcagacccaagcatttgacttttactcaagatattttgcaccgtgggttggtgtggctgaagacccagtgacagggtctgcacacgctgttctcagcagctactggtcccagcatctggggaagaaagaaatgcatgcttttcagtgttcccaccgaggaggagagctgggaatttcccttcgtccagacggaagggttgacattagaggaggtgcagctgttgttttagagggcacactgacagcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 7, member 6 opposite strand
- SH3 domain containing, Ysc84-like 1 (S. cerevisiae)
- calcium channel, voltage-dependent, gamma subunit 4
- ST3 beta-galactoside alpha-2,3-sialyltransferase 6

Buy PBLD-phenazine biosynthesis-like protein domain containing Gene now

Add to cart