PHLDA1-pleckstrin homology-like domain, family A, member 1 Gene View larger

PHLDA1-pleckstrin homology-like domain, family A, member 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PHLDA1-pleckstrin homology-like domain, family A, member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PHLDA1-pleckstrin homology-like domain, family A, member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018929
Product type: DNA & cDNA
Ncbi symbol: PHLDA1
Origin species: Human
Product name: PHLDA1-pleckstrin homology-like domain, family A, member 1 Gene
Size: 2ug
Accessions: BC018929
Gene id: 22822
Gene description: pleckstrin homology-like domain, family A, member 1
Synonyms: DT1P1B11; PHRIP; TDAG51; pleckstrin homology-like domain family A member 1; PQ-rich protein; PQR protein; T-cell death-associated gene 51 protein; apoptosis-associated nuclear protein; proline- and glutamine-rich protein; proline- and histidine-rich protein; proline-histidine rich protein; pleckstrin homology like domain family A member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggagagtagcggctgcaaagcgctgaaggagggcgtgctggagaagcgcagcgacgggttgttgcagctctggaagaaaaagtgttgcatcctcaccgaggaagggctgctgcttatcccgcccaagcagctgcaacaccagcagcagcagcaacagcagcagcagcagcagcaacaacagcccgggcaggggccggccgagccgtcccaacccagtggccccgctgtcgccagcctcgagccgccggtcaagctcaaggaactgcacttctccaacatgaagaccgtggactgtgtggagcgcaagggcaagtacatgtacttcactgtggtgatggcagagggcaaggagatcgactttcggtgcccgcaagaccagggctggaacgccgagatcacgctgcagatggtgcagtacaagaatcgtcaggccatcctggcggtcaaatccacgcggcagaagcagcagcacctggtccagcagcagcccccctcgcagccgcagccgcagccgcagctccagccccaaccccagcctcagcctcagccgcaaccccagccccaatcacaaccccagcctcagccccaacccaagcctcagccccagcagctccacccgtatccgcatccacatccacatccacactctcatcctcactcgcacccacaccctcacccgcacccgcatccgcaccaaataccgcacccacacccacagccgcactcgcagccgcacgggcaccggcttctccgcagcacctccaactctgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) assembly chaperone 2
- membrane-spanning 4-domains, subfamily A, member 12
- coiled-coil domain containing 5 (spindle associated)
- phenazine biosynthesis-like protein domain containing

Buy PHLDA1-pleckstrin homology-like domain, family A, member 1 Gene now

Add to cart