PTXBC018929
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC018929 |
Product type: | DNA & cDNA |
Ncbi symbol: | PHLDA1 |
Origin species: | Human |
Product name: | PHLDA1-pleckstrin homology-like domain, family A, member 1 Gene |
Size: | 2ug |
Accessions: | BC018929 |
Gene id: | 22822 |
Gene description: | pleckstrin homology-like domain, family A, member 1 |
Synonyms: | DT1P1B11; PHRIP; TDAG51; pleckstrin homology-like domain family A member 1; PQ-rich protein; PQR protein; T-cell death-associated gene 51 protein; apoptosis-associated nuclear protein; proline- and glutamine-rich protein; proline- and histidine-rich protein; proline-histidine rich protein; pleckstrin homology like domain family A member 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgctggagagtagcggctgcaaagcgctgaaggagggcgtgctggagaagcgcagcgacgggttgttgcagctctggaagaaaaagtgttgcatcctcaccgaggaagggctgctgcttatcccgcccaagcagctgcaacaccagcagcagcagcaacagcagcagcagcagcagcaacaacagcccgggcaggggccggccgagccgtcccaacccagtggccccgctgtcgccagcctcgagccgccggtcaagctcaaggaactgcacttctccaacatgaagaccgtggactgtgtggagcgcaagggcaagtacatgtacttcactgtggtgatggcagagggcaaggagatcgactttcggtgcccgcaagaccagggctggaacgccgagatcacgctgcagatggtgcagtacaagaatcgtcaggccatcctggcggtcaaatccacgcggcagaagcagcagcacctggtccagcagcagcccccctcgcagccgcagccgcagccgcagctccagccccaaccccagcctcagcctcagccgcaaccccagccccaatcacaaccccagcctcagccccaacccaagcctcagccccagcagctccacccgtatccgcatccacatccacatccacactctcatcctcactcgcacccacaccctcacccgcacccgcatccgcaccaaataccgcacccacacccacagccgcactcgcagccgcacgggcaccggcttctccgcagcacctccaactctgcctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - proteasome (prosome, macropain) assembly chaperone 2 - membrane-spanning 4-domains, subfamily A, member 12 - coiled-coil domain containing 5 (spindle associated) - phenazine biosynthesis-like protein domain containing |