Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMG2-proteasome (prosome, macropain) assembly chaperone 2 Gene
PTXBC013356
New product
Data sheet of PSMG2-proteasome (prosome, macropain) assembly chaperone 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMG2-proteasome (prosome, macropain) assembly chaperone 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013356 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMG2 |
| Origin species: | Human |
| Product name: | PSMG2-proteasome (prosome, macropain) assembly chaperone 2 Gene |
| Size: | 2ug |
| Accessions: | BC013356 |
| Gene id: | 56984 |
| Gene description: | proteasome (prosome, macropain) assembly chaperone 2 |
| Synonyms: | CLAST3; HCCA3; HsT1707; MDS003; PAC2; TNFSF5IP1; proteasome assembly chaperone 2; CD40 ligand-activated specific transcript 3; HDCMC29P; HSPC260; PAC-2; hepatocellular carcinoma susceptibility protein; hepatocellular carcinoma-susceptibility protein 3; likely ortholog of mouse CD40 ligand-activated specific transcript 3 (Clast3); proteasome (prosome, macropain) assembly chaperone 2; proteasome assembling chaperone 2; tumor necrosis factor superfamily member 5-induced protein 1; x 003 protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcgttccctgcggggagtcggcccccgaccttgccggcttcaccctcctaatgccagcagtatctgttggaaatgttggccagcttgcaatggatctgattatttctacactgaatatgtctaagattggttacttctataccgattgtcttgtgccaatggttggaaacaatccatatgcgaccacagaaggaaattcaacagaacttagcataaatgctgaagtgtattcattgccttcaagaaagctggtggctctacagttaagatccatttttattaagtataaatcaaagccgttctgtgaaaaactgctttcctgggtgaaaagcagtggctgtgccagagtcattgttctttcaagcagtcattcatatcagcgtaatgatctgcagcttcgtagtactcccttccggtacctacttacaccttccatgcaaaaaagtgttcaaaataaaataaagagccttaactgggaagaaatggaaaaaagccggtgcattcctgaaatagatgattccgagttttgtatccgcattccgggaggaggtatcacaaaaacactctatgatgaaagctgttctaaagaaatccaaatggcagttctgctgaaatttgtttcagaaggggacaacatcccagatgcattaggtcttgttgagtatcttaatgagtggcttcagatactcaaaccacttagcgatgaccccacagtatctgcctcacggtggaaaataccaagttcttggagattactctttggcagtggtcttccccctgcacttttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - membrane-spanning 4-domains, subfamily A, member 12 - coiled-coil domain containing 5 (spindle associated) - phenazine biosynthesis-like protein domain containing - solute carrier family 7, member 6 opposite strand |