Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PTTG1IP-pituitary tumor-transforming 1 interacting protein Gene
PTXBC000415
New product
Data sheet of PTTG1IP-pituitary tumor-transforming 1 interacting protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTTG1IP-pituitary tumor-transforming 1 interacting protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000415 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTTG1IP |
| Origin species: | Human |
| Product name: | PTTG1IP-pituitary tumor-transforming 1 interacting protein Gene |
| Size: | 2ug |
| Accessions: | BC000415 |
| Gene id: | 754 |
| Gene description: | pituitary tumor-transforming 1 interacting protein |
| Synonyms: | C21orf1; C21orf3; PBF; pituitary tumor-transforming gene 1 protein-interacting protein; PTTG-binding factor; pituitary tumor-transforming gene protein-binding factor; pituitary tumor-transforming 1 interacting protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcccggagtggcccgcgggccgacgccgtactggaggttgcgcctcggtggcgccgcgctgctcctgctgctcatcccggtggccgccgcgcaggagcctcccggagctgcttgttctcagaacacaaacaaaacctgtgaagagtgcctgaagaacgtctcctgtctttggtgcaacactaacaaggcttgtctggactacccagttacaagcgtcttgccaccggcttccctttgtaaattgagctctgcacgctggggagtttgttgggtgaactttgaggcgctgatcatcaccatgtcggtagtcgggggaaccctcctcctgggcattgccatctgctgctgctgctgctgcaggaggaagaggagccggaagccggacaggagtgaggagaaggccatgcgtgagcgggaggagaggcggatacggcaggaggaacggagagcagagatgaagacaagacatgatgaaatcagaaaaaaatatggcctgtttaaagaagaaaacccgtatgctagatttgaaaacaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DR1-associated protein 1 (negative cofactor 2 alpha) - transmembrane and ubiquitin-like domain containing 1 - pleckstrin homology-like domain, family A, member 1 - proteasome (prosome, macropain) assembly chaperone 2 |