Login to display prices
Login to display prices
PTTG1IP-pituitary tumor-transforming 1 interacting protein Gene View larger

PTTG1IP-pituitary tumor-transforming 1 interacting protein Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTTG1IP-pituitary tumor-transforming 1 interacting protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PTTG1IP-pituitary tumor-transforming 1 interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000415
Product type: DNA & cDNA
Ncbi symbol: PTTG1IP
Origin species: Human
Product name: PTTG1IP-pituitary tumor-transforming 1 interacting protein Gene
Size: 2ug
Accessions: BC000415
Gene id: 754
Gene description: pituitary tumor-transforming 1 interacting protein
Synonyms: C21orf1; C21orf3; PBF; pituitary tumor-transforming gene 1 protein-interacting protein; PTTG-binding factor; pituitary tumor-transforming gene protein-binding factor; pituitary tumor-transforming 1 interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcccggagtggcccgcgggccgacgccgtactggaggttgcgcctcggtggcgccgcgctgctcctgctgctcatcccggtggccgccgcgcaggagcctcccggagctgcttgttctcagaacacaaacaaaacctgtgaagagtgcctgaagaacgtctcctgtctttggtgcaacactaacaaggcttgtctggactacccagttacaagcgtcttgccaccggcttccctttgtaaattgagctctgcacgctggggagtttgttgggtgaactttgaggcgctgatcatcaccatgtcggtagtcgggggaaccctcctcctgggcattgccatctgctgctgctgctgctgcaggaggaagaggagccggaagccggacaggagtgaggagaaggccatgcgtgagcgggaggagaggcggatacggcaggaggaacggagagcagagatgaagacaagacatgatgaaatcagaaaaaaatatggcctgtttaaagaagaaaacccgtatgctagatttgaaaacaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DR1-associated protein 1 (negative cofactor 2 alpha)
- transmembrane and ubiquitin-like domain containing 1
- pleckstrin homology-like domain, family A, member 1
- proteasome (prosome, macropain) assembly chaperone 2