NASP-nuclear autoantigenic sperm protein (histone-binding) Gene View larger

NASP-nuclear autoantigenic sperm protein (histone-binding) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NASP-nuclear autoantigenic sperm protein (histone-binding) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NASP-nuclear autoantigenic sperm protein (histone-binding) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003113
Product type: DNA & cDNA
Ncbi symbol: NASP
Origin species: Human
Product name: NASP-nuclear autoantigenic sperm protein (histone-binding) Gene
Size: 2ug
Accessions: BC003113
Gene id: 4678
Gene description: nuclear autoantigenic sperm protein (histone-binding)
Synonyms: NASP histone chaperone; FLB7527; HMDRA1; PRO1999; nuclear autoantigenic sperm protein; histone H1-binding protein; nuclear autoantigenic sperm protein (histone-binding)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccatggagtccacagccactgccgccgtcgccgcggagctggtttctgccgacaaaattgaagatgttcctgctccttctacatctgcagataaagtggagagtctggatgtggatagtgaagctaagaaactattgggtttaggacagaaacatctggtgatgggggatattccagcagctgtcaatgcattccaggaagcagctagtcttttaggtaagaagtatggagagacagctaatgagtgtggagaagccttctttttctatgggaaatcacttctggagttggcaagaatggagaatggtgtgttgggaaacgccttggaaggtgtgcatgtggaagaggaagaaggagaaaaaacagaagatgaatctctggtagaaaataatgataacatagatgaaactgaaggctcggaagaggatgataaagaaaatgataagactgaagaaatgccaaatgattcagtccttgaaaacaagtctcttcaagaaaatgaggaggaggagattgggaacctagagcttgcctgggatatgctggatttagcaaagatcatttttaaaaggcaagaaacaaaagaagcacagctttatgctgcccaggcacatcttaaactcggagaagttagtgttgaatctgaaaactatgtgcaagctgtggaggagttccagtcctgccttaacctgcaggaacagtacctggaagcccacgaccgtctccttgcagagacccactaccagctgggcttggcttatgggtacaactctcagtatgatgaggcagtggcacagttcagcaaatctattgaagtcattgagaacagaatggctgtactaaacgagcaggtgaaggaggctgaaggatcgtctgctgaatacaagaaagaaattgaggaactaaaggaactgctacccgaaattagagagaagatagaagatgcaaaggagtctcagcgtagtgggaatgtagctgaactggctctgaaagctactctggtggagagttctacttcaggtttcactcctggtggaggaggctcttcagtctccatgattgccagtagaaagccaacagacggtgcttcctcatcaaattgtgtgactgatatttcccaccttgtcagaaagaagaggaaaccagaggaagagagtccccggaaagatgatgcaaagaaagccaaacaagagccggaggtgaacggaggcagtggggatgctgtccccagtggaaatgaagtttcggaaaacatggaggaggaggctgagaatcaggctgaaagccgggcagcagtggaggggacagtggaggctggagctacagttgaaagcactgcatgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tRNA splicing endonuclease 2 homolog (S. cerevisiae)
- APEX nuclease (apurinic/apyrimidinic endonuclease) 2
- karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
- staufen, RNA binding protein, homolog 2 (Drosophila)

Buy NASP-nuclear autoantigenic sperm protein (histone-binding) Gene now

Add to cart