MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene View larger

MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene

PTXBC028425

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028425
Product type: DNA & cDNA
Ncbi symbol: MLC1
Origin species: Human
Product name: MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene
Size: 2ug
Accessions: BC028425
Gene id: 23209
Gene description: megalencephalic leukoencephalopathy with subcortical cysts 1
Synonyms: membrane protein MLC1; LVM; MLC; megalencephalic leukoencephalopathy with subcortical cysts 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccaggagccattcagagaggagctggcctatgaccggatgcccacgctggagcggggccggcaagaccacgccagctatgccccagacgcgaagccgagcgacctgcagctgtcgaagagactgcccccctgcttcagccacaagacgtgggtcttctctgtgctgatggggagctgcctcctggtgacctcggggttttcgctgtacctggggaacgtgttcccggctgagatggattacttgcgctgtgctgcaggctcttgcatcccctcggcaattgtgagcttcaccgtctccaggaggaacgccaatgtgattcccaactttcagatattgtttgtttccacgtttgctgtgaccactacgtgtttaatttggtttggatgcaaactagtcctgaacccatcagcaataaacatcaacttcaacctcatcctgctgctcctgctggagctgctcatggcggccacggtgatcatcgctgcacggtccagcgaggaggactgcaagaaaaagaagggctccatgtctgacagcgccaacattctggacgaagtgccatttcctgctcgggtcctgaaatcttactcagtcgtcgaggtaatcgcaggcatctctgccgtcctcggggggatcattgccctgaacgtggatgactcagtttcaggcccacacctctcagtgacgttcttttggatcctagtggcctgctttccaagtgccattgccagtcatgtggcagcagagtgtcccagcaagtgtctggtggaggtcctgattgccataagcagcctcacgtctccgctgctgttcacagcctctggatatctgtcattcagcatcatgagaatcgtggagatgtttaaggattacccgccagccataaaaccatcctacgatgtgctgctgctgctgctgctgctagtgctcctgctgcaggccggcctcaacacgggcaccgccatccagtgcgtgcgcttcaaggtcagtgcaaggctgcagggtgcatcctgggacacccagaacggcccgcaggagcgcctggctggggaggtggccaggagccccctgaaggagttcgacaaggagaaagcctggagagccgtcgtggtgcaaatggcccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
- ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
- nudix (nucleoside diphosphate linked moiety X)-type motif 3
- nudix (nucleoside diphosphate linked moiety X)-type motif 4

Buy MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene now

Add to cart