GABRA2-gamma-aminobutyric acid (GABA) A receptor, alpha 2 Gene View larger

GABRA2-gamma-aminobutyric acid (GABA) A receptor, alpha 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GABRA2-gamma-aminobutyric acid (GABA) A receptor, alpha 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GABRA2-gamma-aminobutyric acid (GABA) A receptor, alpha 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022488
Product type: DNA & cDNA
Ncbi symbol: GABRA2
Origin species: Human
Product name: GABRA2-gamma-aminobutyric acid (GABA) A receptor, alpha 2 Gene
Size: 2ug
Accessions: BC022488
Gene id: 2555
Gene description: gamma-aminobutyric acid (GABA) A receptor, alpha 2
Synonyms: gamma-aminobutyric acid receptor subunit alpha-2; GABA(A) receptor subunit alpha-2; gamma-aminobutyric acid type A receptor alpha2 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagacaaaattgaacatctacaacatgcagttcctgctttttgttttcttggtgtgggaccctgccaggttggtgctggctaacatccaagaagatgaggctaaaaataacattaccatctttacgagaattcttgacagacttctggatggttacgataatcggcttagaccaggactgggagacagtattactgaagtcttcactaacatctacgtgaccagttttggccctgtctcagatacagatatggaatatacaattgatgttttctttcgacaaaaatggaaagatgaacgtttaaaatttaaaggtcctatgaatatccttcgactaaacaatttaatggctagcaaaatctggactccagataccttttttcacaatgggaaaaaatcagcagctcataatatgacaatgccaaataagttgcttcgaattcaggatgatgggactctgctgtataccatgaggcttacagttcaagctgaatgcccaatgcacttggaggatttcccaatggatgctcattcatgtcctctgaaatttggcagctatgcatatacaacttcagaggtcacttatatttggacttacaatgcatctgattcagtacaggttgctcctgatggctctaggttaaatcaatatgacctgctgggccaatcaatcggaaaggagacaattaaatccagtacaggtgaatatactgtaatgacagctcatttccacctgaaaagaaaaattgggtattttgtgattcaaacctatctgccttgcatcatgactgtcattctctcccaagtttcattctggcttaacagagaatctgtgcctgcaagaactgtgtttggagtaacaactgtcctaacaatgacaactctaagcatcagtgctcggaattctctccccaaagtggcttatgcaactgccatggactggtttattgctgtttgttatgcatttgtgttctctgccctaattgaatttgcaactgttaattacttcaccaaaagaggatgggcttgggatgggaagagtgtagtaaatgacaaggtaagtgagagcttccgtgttatcattattaagaaaataccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - intraflagellar transport 57 homolog (Chlamydomonas)
- G protein regulated inducer of neurite outgrowth 2
- eukaryotic translation elongation factor 1 alpha 2
- ribosomal protein S6 kinase, 90kDa, polypeptide 5

Buy GABRA2-gamma-aminobutyric acid (GABA) A receptor, alpha 2 Gene now

Add to cart