GPRIN2-G protein regulated inducer of neurite outgrowth 2 Gene View larger

GPRIN2-G protein regulated inducer of neurite outgrowth 2 Gene

PTXBC011672

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPRIN2-G protein regulated inducer of neurite outgrowth 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPRIN2-G protein regulated inducer of neurite outgrowth 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011672
Product type: DNA & cDNA
Ncbi symbol: GPRIN2
Origin species: Human
Product name: GPRIN2-G protein regulated inducer of neurite outgrowth 2 Gene
Size: 2ug
Accessions: BC011672
Gene id: 9721
Gene description: G protein regulated inducer of neurite outgrowth 2
Synonyms: KIAA0514; G protein-regulated inducer of neurite outgrowth 2; G protein regulated inducer of neurite outgrowth 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctccagccaccccgagccgggtccctgggcacccctgagcccccgccttcagcccctgtcccagagctcttccagcctgctgggtgaaggccgggaacagaggccagagctccacaagactgccagcagcaccatgtggcaggcccagctgggcgaggccagcaccagaccccaggccccggaggaagaggggaacccgcctgagagcatgaagccagcacgggcctctggccccaaggcgcgacccagtgctggaggccactggcggagcagcactgtgggcaatgtgtccaccatgggcggtggtgacctttgtcgcctgcgggcccctagtgctgctgctatgcagaggagccattcagacctggtccgtagcacccagatgcggggacacagtggtgctcggaaggccagtctcagctgctcagcccttggcagcagccctgtccacagggctcagctgcagccaggtggtacttctggccagggtggccaggcccctgcaggcctggaaagggacctggctcctgaggatgagacttctaactcagcctggatgctgggggcgagtcagttgtcggtgccaccactagacctgggggacacaactgcccacagcagcagtgcccaggctgagcccaaagctgctgaacagctggctaccaccacctgccatgctctgcccccagctgctctactctgtggcatgagggagatgagggaggtgggggctggtggctgctgccatgccctacctgccacagggatcctggcctttcccaaactagtggcgtcagtgagcgagtctgggctgcaggctcagcatggggtgaagatccactgtaggttgtctggggggctccctgggcactcccattgctgtgcccacctttggggtcccgctgggttagtcccagagcctggctctaggaccaaagatgtgtggaccatgacctcagccaatgacttggcccctgcagaggcatccccgctgtcagcccaggatgctggtgtgcaggcggccccagtggcggcctgcaaggctgtggccaccagtccgtccctggaagcgcctgcagccctgcatgtgttcccagaggtaactctggggtccagcctggaggaggcgccgtcccctgtgcgggatgtgcgatgggatgctgagggcatgacatgggaggtgtacggagctgcggtggacccggaggtgctcggtgtggccatccagaagcacctggagatgcagtttgagcagctgcagcgggcgcctgccagcgaggacagcctgtctgtggagggccggagggggccgctgcgggctgtcatgcagtccctgcggcgccccagctgctgcggctgctctggcgcggcccccgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation elongation factor 1 alpha 2
- ribosomal protein S6 kinase, 90kDa, polypeptide 5
- vacuolar protein sorting 18 homolog (S. cerevisiae)
- vesicle-associated membrane protein 3 (cellubrevin)

Buy GPRIN2-G protein regulated inducer of neurite outgrowth 2 Gene now

Add to cart