EEF1A2-eukaryotic translation elongation factor 1 alpha 2 Gene View larger

EEF1A2-eukaryotic translation elongation factor 1 alpha 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EEF1A2-eukaryotic translation elongation factor 1 alpha 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EEF1A2-eukaryotic translation elongation factor 1 alpha 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000432
Product type: DNA & cDNA
Ncbi symbol: EEF1A2
Origin species: Human
Product name: EEF1A2-eukaryotic translation elongation factor 1 alpha 2 Gene
Size: 2ug
Accessions: BC000432
Gene id: 1917
Gene description: eukaryotic translation elongation factor 1 alpha 2
Synonyms: EEF1AL; EF-1-alpha-2; EF1A; EIEE33; HS1; MRD38; STN; STNL; elongation factor 1-alpha 2; eukaryotic elongation factor 1 A-2; statin-S1; eukaryotic translation elongation factor 1 alpha 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcaaggagaagacccacatcaacatcgtggtcatcggccacgtggactccggaaagtccaccaccacgggccacctcatctacaaatgcggaggtattgacaaaaggaccattgagaagttcgagaaggaggcggctgagatggggaagggatccttcaagtatgcctgggtgctggacaagctgaaggcggagcgtgagcgcggcatcaccatcgacatctccctctggaagttcgagaccaccaagtactacatcaccatcatcgatgcccccggccaccgcgacttcatcaagaacatgatcacgggtacatcccaggcggactgcgcagtgctgatcgtggcggcgggcgtgggcgagttcgaggcgggcatctccaagaatgggcagacgcgggagcatgccctgctggcctacacgctgggtgtgaagcagctcatcgtgggcgtgaacaaaatggactccacagagccggcctacagcgagaagcgctacgacgagatcgtcaaggaagtcagcgcctacatcaagaagatcggctacaacccggccaccgtgccctttgtgcccatctccggctggcacggtgacaacatgctggagccctcccccaacatgccgtggttcaagggctggaaggtggagcgtaaggagggcaacgcaagcggcgtgtccctgctggaggccctggacaccatcctgccccccacgcgccccacggacaagcccctgcgcctgccgctgcaggacgtgtacaagattggcggcattggcacggtgcccgtgggccgggtggagaccggcatcctgcggccgggcatggtggtgacctttgcgccagtgaacatcaccactgaggtgaagtcagtggagatgcaccacgaggctctgagcgaagctctgcccggcgacaacgtcggcttcaatgtgaagaacgtgtcggtgaaggacatccggcggggcaacgtgtgtggggacagcaagtctgacccgccgcaggaggctgctcagttcacctcccaggtcatcatcctgaaccacccggggcagattagcgccggctactccccggtcatcgactgccacacagcccacatcgcctgcaagtttgcggagctgaaggagaagattgaccggcgctctggcaagaagctggaggacaaccccaagtccctgaagtctggagacgcggccatcgtggagatggtgccgggaaagcccatgtgtgtggagagcttctcccagtacccgcctctcggccgcttcgccgtgcgcgacatgaggcagacggtggccgtaggcgtcatcaagaacgtggagaagaagagcggcggcgccggcaaggtcaccaagtcggcgcagaaggcgcagaaggcgggcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S6 kinase, 90kDa, polypeptide 5
- vacuolar protein sorting 18 homolog (S. cerevisiae)
- vesicle-associated membrane protein 3 (cellubrevin)
- vesicle-associated membrane protein 3 (cellubrevin)

Buy EEF1A2-eukaryotic translation elongation factor 1 alpha 2 Gene now

Add to cart