Login to display prices
Login to display prices
RPS6KA5-ribosomal protein S6 kinase, 90kDa, polypeptide 5 Gene View larger

RPS6KA5-ribosomal protein S6 kinase, 90kDa, polypeptide 5 Gene

PTXBC017187

New product

Data sheet of RPS6KA5-ribosomal protein S6 kinase, 90kDa, polypeptide 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPS6KA5-ribosomal protein S6 kinase, 90kDa, polypeptide 5 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC017187
Product type: DNA & cDNA
Ncbi symbol: RPS6KA5
Origin species: Human
Product name: RPS6KA5-ribosomal protein S6 kinase, 90kDa, polypeptide 5 Gene
Size: 2ug
Accessions: BC017187
Gene id: 9252
Gene description: ribosomal protein S6 kinase, 90kDa, polypeptide 5
Synonyms: MSK1; MSPK1; RLPK; ribosomal protein S6 kinase alpha-5; 90 kDa ribosomal protein S6 kinase 5; RSK-like protein kinase; RSKL; S6K-alpha-5; nuclear mitogen- and stress-activated protein kinase 1; ribosomal protein S6 kinase, 90kDa, polypeptide 5; ribosomal protein S6 kinase A5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaggagggtggcagcagcggcggcgccgcggggaccagcgcggacggcggcgacggaggagagcagctcctcactgtcaagcacgagctgcggactgctaatttgacaggacatgctgagaaggtgggaatagaaaattttgagctcctgaaggtcctaggaactggagcttatggaaaagtatttctagttcgtaaaataagtggccatgatactggaaagctgtatgccatgaaagttttgaaaaaggcaacaatcgttcaaaaggccaaaaccacagagcatacaaggacagaacgacaagtcctggaacacattaggcagtcgccatttttggtaacattacattatgctttccagacagaaaccaaacttcatctcattttagattatataaatggtggtgaactttttactcatctttctcaaagagagcgtttcacagagcatgaggtgcagatttatgttggagagattgtgcttgccctcgaacatctccacaagttggggattatatatcgtgatattaagcttgagaatattctacttgattctaatggccatgtggtgctgacagattttggtctgagtaaggagtttgtggctgatgaaactgaaagagcatattccttttgtggaactattgaatacatggcaccagatattgtcagagggggagattcaggacatgacaaggcagttgactggtggagtttgggtgttctaatgtatgaattactaactggagcatctcctttcactgttgatggagaaaaaaattcccaagctgagatatctaggagaatattaaaaagtgagcctccatatccccaagaaatgagtgctttagcgaaagacctaattcagcgtcttttgatgaaagatcccaagaagagattgggatgtggtccacgtgatgcagatgaaatcaaagaacatctcttctttcagaaaataaattgggatgatttagccgccaaaaaagtgcctgcaccatttaagccagtcattcgagatgaattagatgtgagtaactttgcagaagagttcacagaaatggatcccacttattctcccgcagccctgccccagagttctgagaagctgtttcagggctattcctttgttgctccttccatcctattcaagcgtaatgcagctgtcatagaccctcttcagtttcacatgggagttgaacgtcctggagtgacaaatgttgccaggagtgcaatgatgaaggactctccattctatcaacactatgacctagatttgaaggacaaacccctgggagaaggtagtttttcaatttgtcgaaagtgtgtgcataaaaaaagtaaccaagcttttgcagtcaaaataatcagcaaaaggatggaagccaatactcaaaaggaaataacagctctgaaactctgtgaaggacaccccaatattgtgaagttgcatgaagtttttcatgatcagcttcacacgtttctagtgatggaacttctgaatggaggagaactgtttgagcgcattaagaaaaagaagcacttcagtgagacggaagccagctacatcatgaggaagcttgtttcagctgtaagccacatgcatgatgttggagtggtgcacagggatctgaaacctgaggtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vacuolar protein sorting 18 homolog (S. cerevisiae)
- vesicle-associated membrane protein 3 (cellubrevin)
- vesicle-associated membrane protein 3 (cellubrevin)
- integrin beta 3 binding protein (beta3-endonexin)