Login to display prices
Login to display prices
IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene View larger

IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene

PTXBC011899

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene

Proteogenix catalog: PTXBC011899
Ncbi symbol: IFT57
Product name: IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene
Size: 2ug
Accessions: BC011899
Gene id: 55081
Gene description: intraflagellar transport 57 homolog (Chlamydomonas)
Synonyms: ESRRBL1; HIPPI; MHS4R2; intraflagellar transport protein 57 homolog; HIP1 protein interactor; HIP1-interacting protein; dermal papilla-derived protein 8; estrogen-related receptor beta like 1; estrogen-related receptor beta-like protein 1; huntingtin interacting protein-1 interacting protein; intraflagellar transport 57 homolog; intraflagellar transport 57
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgctgctctggccgtcgtcacgacgtcgggtttggaagatggggtgcctaggtcccgtggcgaagggaccggggaagtggtcttggagcgggggcccggcgcggcctaccacatgttcgtggtgatggaggacttggtggagaagctgaagctgctccgctacgaggaggagttcctccggaagagcaacctgaaggccccgtccagacactattttgcactgcctaccaaccctggcgaacagttctacatgttttgtactcttgctgcttggttgattaataaagcgggacgtccctttgagcagcctcaagaatatgatgaccctaatgcaacaatatctaacatactatccgagcttcggtcatttggaagaactgcagattttcctccttcaaaattaaagtcaggttatggagaacatgtatgctatgttcttgattgcttcgctgaagaagcattgaaatatattggtttcacctggaaaaggccaatatacccagtagaagaattagaagaagaaagcgttgcagaagatgatgcagaattaacattaaataaagtggatgaagaatttgtggaagaagagacagataatgaagaaaactttattgatctcaacgttttaaaggcccagacatatcacttggatatgaacgagactgccaaacaagaagatattttggaatccacaacagatgctgcagaatggagcctagaagtggaacgtgtactaccgcaactgaaagtcacgattaggactgacaataaggattggagaatccatgttgaccaaatgcaccagcacagaagtggaattgaatctgctctaaaggagaccaagggatttttggacaaactccataatgaaattactaggactttggaaaagatcagcagccgagaaaagtacatcaacaatcagcttgagaatttggttcaagaatatcgtgcagctcaagcccagctgagtgaggcaaaggagcgataccagcagggaaatggaggagtgacggaaagaaccagactcctctctgaggttatggaagaattagaaaaggtaaaacaagaaatggaagaaaagggcagcagcatgactgatggtgctcctttggtgaagattaaacagagcttaacaaaactgaagcaagaaactgtagagatggacattagaattggcattgtggaacacacactactccaatcaaagctgaaggagaagtccaacatgactaggaacatgcatgccacagttattccagaaccagcaacaggcttttattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: