IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene View larger

IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011899
Product type: DNA & cDNA
Ncbi symbol: IFT57
Origin species: Human
Product name: IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene
Size: 2ug
Accessions: BC011899
Gene id: 55081
Gene description: intraflagellar transport 57 homolog (Chlamydomonas)
Synonyms: ESRRBL1; HIPPI; MHS4R2; intraflagellar transport protein 57 homolog; HIP1 protein interactor; HIP1-interacting protein; dermal papilla-derived protein 8; estrogen-related receptor beta like 1; estrogen-related receptor beta-like protein 1; huntingtin interacting protein-1 interacting protein; intraflagellar transport 57 homolog; intraflagellar transport 57
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgctgctctggccgtcgtcacgacgtcgggtttggaagatggggtgcctaggtcccgtggcgaagggaccggggaagtggtcttggagcgggggcccggcgcggcctaccacatgttcgtggtgatggaggacttggtggagaagctgaagctgctccgctacgaggaggagttcctccggaagagcaacctgaaggccccgtccagacactattttgcactgcctaccaaccctggcgaacagttctacatgttttgtactcttgctgcttggttgattaataaagcgggacgtccctttgagcagcctcaagaatatgatgaccctaatgcaacaatatctaacatactatccgagcttcggtcatttggaagaactgcagattttcctccttcaaaattaaagtcaggttatggagaacatgtatgctatgttcttgattgcttcgctgaagaagcattgaaatatattggtttcacctggaaaaggccaatatacccagtagaagaattagaagaagaaagcgttgcagaagatgatgcagaattaacattaaataaagtggatgaagaatttgtggaagaagagacagataatgaagaaaactttattgatctcaacgttttaaaggcccagacatatcacttggatatgaacgagactgccaaacaagaagatattttggaatccacaacagatgctgcagaatggagcctagaagtggaacgtgtactaccgcaactgaaagtcacgattaggactgacaataaggattggagaatccatgttgaccaaatgcaccagcacagaagtggaattgaatctgctctaaaggagaccaagggatttttggacaaactccataatgaaattactaggactttggaaaagatcagcagccgagaaaagtacatcaacaatcagcttgagaatttggttcaagaatatcgtgcagctcaagcccagctgagtgaggcaaaggagcgataccagcagggaaatggaggagtgacggaaagaaccagactcctctctgaggttatggaagaattagaaaaggtaaaacaagaaatggaagaaaagggcagcagcatgactgatggtgctcctttggtgaagattaaacagagcttaacaaaactgaagcaagaaactgtagagatggacattagaattggcattgtggaacacacactactccaatcaaagctgaaggagaagtccaacatgactaggaacatgcatgccacagttattccagaaccagcaacaggcttttattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein regulated inducer of neurite outgrowth 2
- eukaryotic translation elongation factor 1 alpha 2
- ribosomal protein S6 kinase, 90kDa, polypeptide 5
- vacuolar protein sorting 18 homolog (S. cerevisiae)

Buy IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene now

Add to cart