Cart 1 Product Products 121,50 € (empty)
-
1 x C19orf62-c...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
View larger 
RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene
PTXBC001811
New product
Data sheet of RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001811 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RRS1 |
| Origin species: | Human |
| Product name: | RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC001811 |
| Gene id: | 23212 |
| Gene description: | RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) |
| Synonyms: | ribosome biogenesis regulatory protein RRS1 homolog; homolog of yeast ribosome biogenesis regulatory protein RRS1; RRS1 ribosome biogenesis regulator homolog; ribosome biogenesis regulatory protein homolog; homolog of yeast ribosome biogenesis regulator; ribosome biogenesis regulator homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagggccagagcgtggaggagctgctcgcaaaggcagagcaggacgaggcagagaagttgcaacgcatcacggtgcacaaggagctggagctgcagtttgacctgggcaacctgctggcgtcggaccggaaccccccgaccgggctgcggtgcgccggacccacgccggaggccgagctacaggccctggcgcgggacaacacgcaactgctcatcaaccagctgtggcagctgcccacggagcgcgtggaagaggcgatagtggcgcggctgccggagcccaccacacgcctgccgcgagagaagcctctgccccgaccgcggccacttacacgctggcagcagttcgcgcgcctcaagggcatccgtcccaagaagaagaccaacctggtgtgggacgaggtgagtggccagtggcggcggcgctggggctaccagcgcgcccgggacgacaccaaagaatggctgattgaggtgcccggcaatgccgaccccttggaggaccagttcgccaagcggattcaggccaagaaggaaagggtggccaagaacgagctgaaccggctgcgtaacctggcccgcgcgcacaagatgcagctgcccagcgcggccggcttgcaccctaccggacaccagagtaaggaggagctgggccgcgccatgcaagtggccaaggtctccaccgcctctgtggggcgctttcaggagcgcctccccaaggagaaggtgccccggggctccggcaagaaaaggaagtttcaaccccttttcggggactttgcagccgagaaaaagaaccagttggagctgcttcgtgtcatgaacagcaagaagcctcagctggatgtgactagggccaccaataagcagatgagggaggaggaccaggaggaggccgccaagaggaggaaaatgagccagaagggcaagagaaagggaggccggcaggggcctgggggcaagaggaaagggggcccgcccagccagggagggaagaggaaagggggcttgggaggcaagatgaattctgggccgcctggcttgggtggcaagagaaaaggaggacagcgcccaggaggaaagaggaggaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coagulation factor C homolog, cochlin (Limulus polyphemus) - polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa - cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa - phospholipase A2, group IIA (platelets, synovial fluid) |