RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene View larger

RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001811
Product type: DNA & cDNA
Ncbi symbol: RRS1
Origin species: Human
Product name: RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC001811
Gene id: 23212
Gene description: RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)
Synonyms: ribosome biogenesis regulatory protein RRS1 homolog; homolog of yeast ribosome biogenesis regulatory protein RRS1; RRS1 ribosome biogenesis regulator homolog; ribosome biogenesis regulatory protein homolog; homolog of yeast ribosome biogenesis regulator; ribosome biogenesis regulator homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagggccagagcgtggaggagctgctcgcaaaggcagagcaggacgaggcagagaagttgcaacgcatcacggtgcacaaggagctggagctgcagtttgacctgggcaacctgctggcgtcggaccggaaccccccgaccgggctgcggtgcgccggacccacgccggaggccgagctacaggccctggcgcgggacaacacgcaactgctcatcaaccagctgtggcagctgcccacggagcgcgtggaagaggcgatagtggcgcggctgccggagcccaccacacgcctgccgcgagagaagcctctgccccgaccgcggccacttacacgctggcagcagttcgcgcgcctcaagggcatccgtcccaagaagaagaccaacctggtgtgggacgaggtgagtggccagtggcggcggcgctggggctaccagcgcgcccgggacgacaccaaagaatggctgattgaggtgcccggcaatgccgaccccttggaggaccagttcgccaagcggattcaggccaagaaggaaagggtggccaagaacgagctgaaccggctgcgtaacctggcccgcgcgcacaagatgcagctgcccagcgcggccggcttgcaccctaccggacaccagagtaaggaggagctgggccgcgccatgcaagtggccaaggtctccaccgcctctgtggggcgctttcaggagcgcctccccaaggagaaggtgccccggggctccggcaagaaaaggaagtttcaaccccttttcggggactttgcagccgagaaaaagaaccagttggagctgcttcgtgtcatgaacagcaagaagcctcagctggatgtgactagggccaccaataagcagatgagggaggaggaccaggaggaggccgccaagaggaggaaaatgagccagaagggcaagagaaagggaggccggcaggggcctgggggcaagaggaaagggggcccgcccagccagggagggaagaggaaagggggcttgggaggcaagatgaattctgggccgcctggcttgggtggcaagagaaaaggaggacagcgcccaggaggaaagaggaggaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coagulation factor C homolog, cochlin (Limulus polyphemus)
- polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
- cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
- phospholipase A2, group IIA (platelets, synovial fluid)

Buy RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene now

Add to cart