Login to display prices
Login to display prices
RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene View larger

RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene

PTXBC001811

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC001811
Ncbi symbol: RRS1
Product name: RRS1-RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC001811
Gene id: 23212
Gene description: RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)
Synonyms: ribosome biogenesis regulatory protein RRS1 homolog; homolog of yeast ribosome biogenesis regulatory protein RRS1; RRS1 ribosome biogenesis regulator homolog; ribosome biogenesis regulatory protein homolog; homolog of yeast ribosome biogenesis regulator; ribosome biogenesis regulator homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagggccagagcgtggaggagctgctcgcaaaggcagagcaggacgaggcagagaagttgcaacgcatcacggtgcacaaggagctggagctgcagtttgacctgggcaacctgctggcgtcggaccggaaccccccgaccgggctgcggtgcgccggacccacgccggaggccgagctacaggccctggcgcgggacaacacgcaactgctcatcaaccagctgtggcagctgcccacggagcgcgtggaagaggcgatagtggcgcggctgccggagcccaccacacgcctgccgcgagagaagcctctgccccgaccgcggccacttacacgctggcagcagttcgcgcgcctcaagggcatccgtcccaagaagaagaccaacctggtgtgggacgaggtgagtggccagtggcggcggcgctggggctaccagcgcgcccgggacgacaccaaagaatggctgattgaggtgcccggcaatgccgaccccttggaggaccagttcgccaagcggattcaggccaagaaggaaagggtggccaagaacgagctgaaccggctgcgtaacctggcccgcgcgcacaagatgcagctgcccagcgcggccggcttgcaccctaccggacaccagagtaaggaggagctgggccgcgccatgcaagtggccaaggtctccaccgcctctgtggggcgctttcaggagcgcctccccaaggagaaggtgccccggggctccggcaagaaaaggaagtttcaaccccttttcggggactttgcagccgagaaaaagaaccagttggagctgcttcgtgtcatgaacagcaagaagcctcagctggatgtgactagggccaccaataagcagatgagggaggaggaccaggaggaggccgccaagaggaggaaaatgagccagaagggcaagagaaagggaggccggcaggggcctgggggcaagaggaaagggggcccgcccagccagggagggaagaggaaagggggcttgggaggcaagatgaattctgggccgcctggcttgggtggcaagagaaaaggaggacagcgcccaggaggaaagaggaggaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: