Login to display prices
Login to display prices
MAPK13-mitogen-activated protein kinase 13 Gene View larger

MAPK13-mitogen-activated protein kinase 13 Gene

PTXBC000433

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAPK13-mitogen-activated protein kinase 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAPK13-mitogen-activated protein kinase 13 Gene

Proteogenix catalog: PTXBC000433
Ncbi symbol: MAPK13
Product name: MAPK13-mitogen-activated protein kinase 13 Gene
Size: 2ug
Accessions: BC000433
Gene id: 5603
Gene description: mitogen-activated protein kinase 13
Synonyms: MAPK 13; MAPK-13; PRKM13; SAPK4; p38delta; mitogen-activated protein kinase 13; MAP kinase 13; MAP kinase p38 delta; mitogen-activated protein kinase p38 delta; stress-activated protein kinase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcctcatccggaaaaagggcttctacaagcaggacgtcaacaagaccgcctgggagctgcccaagacctacgtgtccccgacgcacgtcggcagcggggcctatggctccgtgtgctcggccatcgacaagcggtcaggggagaaggtggccatcaagaagctgagccgaccctttcagtccgagatcttcgccaagcgcgcctaccgggagctgctgctgctgaagcacatgcagcatgagaacgtcattgggctcctggatgtcttcaccccagcctcctccctgcgcaacttctatgacttctacctggtgatgcccttcatgcagacggatctgcagaagatcatggggatggagttcagtgaggagaagatccagtacctggtgtatcagatgctcaaaggccttaagtacatccactctgctggggtcgtgcacagggacctgaagccaggcaacctggctgtgaatgaggactgtgaactgaagattctggattttgggctggcgcgacatgcagacgccgagatgactggctacgtggtgacccgctggtaccgagcccccgaggtgatcctcagctggatgcactacaaccagacagtggacatctggtctgtgggctgtatcatggcagagatgctgacagggaaaactctgttcaaggggaaagattacctggaccagctgacccagatcctgaaagtgaccggggtgcctggcacggagtttgtgcagaagctgaacgacaaagcggccaaatcctacatccagtccctgccacagacccccaggaaggatttcactcagctgttcccacgggccagcccccaggctgcggacctgctggagaagatgctggagctagacgtggacaagcgcctgacggccgcgcaggccctcacccatcccttctttgaacccttccgggaccctgaggaagagacggaggcccagcagccgtttgatgattccttagaacacgagaaactcacagtggatgaatggaagcagcacatctacaaggagattgtgaacttcagccccattgcccggaaggactcacggcgccggagtggcatgaagctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: