PPME1-protein phosphatase methylesterase 1 Gene View larger

PPME1-protein phosphatase methylesterase 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPME1-protein phosphatase methylesterase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPME1-protein phosphatase methylesterase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003046
Product type: DNA & cDNA
Ncbi symbol: PPME1
Origin species: Human
Product name: PPME1-protein phosphatase methylesterase 1 Gene
Size: 2ug
Accessions: BC003046
Gene id: 51400
Gene description: protein phosphatase methylesterase 1
Synonyms: PME-1; protein phosphatase methylesterase 1; testicular secretory protein Li 39
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggccctcgaaaagagcatgcacctcggccgccttccctctcgcccacctctacccggcagcgggggcagtcagagcggagccaagatgcgaatgggccctggaagaaagcgggacttttcccctgttccttggagtcagtattttgagtccatggaagatgtagaagtagagaatgaaactggcaaggatacttttcgagtctacaagagtggttcagagggtccagtcctgctccttctgcatggaggaggtcattctgccctttcttgggctgtgttcacggcagcgattattagtagagttcagtgtaggattgtagctttggatctgcgaagtcatggtgaaacaaaggtcaagaatcctgaagatctgtctgcagaaacaatggcaaaagacgttggcaatgtggttgaagccatgtatggggaccttcctcctccaattatgctgattggacatagcatgggtggtgctattgcagtccacacagcatcatccaacctggtaccaagcctcttgggtctgtgcatgattgatgttgtagaaggtacagctatggatgcacttaatagcatgcagaatttcttacggggtcgtcctaaaaccttcaagtctctggagaatgctattgaatggagtgtgaagagtggccagattcgaaatctggagtctgcccgtgtctcaatggttggccaagtcaaacagtgtgaaggaattacaagtccagaaggctcaaaatctatagtggaaggaatcatagaggaagaagaagaagatgaggaaggaagtgagtctataagcaagaggaaaaaggaagatgacatggagaccaagaaagaccatccatacacctggagaattgaactggcaaaaacagaaaaatactgggacggctggttccgaggcttatccaatctctttcttagttgtcccattcctaaattgctgctcttggctggtgttgatagattggataaagatctgaccattggccagatgcaagggaagttccagatgcaggtcctaccccagtgtggccatgcagtccatgaggatgcccctgacaaggtagctgaagctgttgccactttcctgatccggcacaggtttgcagaacccatcggtggattccagtgtgtgtttcctggctgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KTEL (Lys-Tyr-Glu-Leu) containing 1
- chromosome 9 open reading frame 68
- arylacetamide deacetylase (esterase)
- chromosome 2 open reading frame 24

Buy PPME1-protein phosphatase methylesterase 1 Gene now

Add to cart