AADAC-arylacetamide deacetylase (esterase) Gene View larger

AADAC-arylacetamide deacetylase (esterase) Gene

PTXBC032309

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AADAC-arylacetamide deacetylase (esterase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AADAC-arylacetamide deacetylase (esterase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032309
Product type: DNA & cDNA
Ncbi symbol: AADAC
Origin species: Human
Product name: AADAC-arylacetamide deacetylase (esterase) Gene
Size: 2ug
Accessions: BC032309
Gene id: 13
Gene description: arylacetamide deacetylase (esterase)
Synonyms: CES5A1; DAC; arylacetamide deacetylase; arylacetamide deacetylase (esterase)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaagaaaatcgctgtaccttctgattgtggggatcctcatagcatattatatttatacgcctctcccagataacgttgaggagccatggagaatgatgtggataaacgcacatctgaaaactatacaaaatttggctacatttgtggagctcctgggacttcaccattttatggattcctttaaggttgtcgggagctttgatgaagtcccaccaacctcagatgaaaatgtcactgtgactgagacaaaattcaacaacattcttgttcgggtatatgtgccaaagagaaagtctgaagcactaagaagggggttgttttacatccatggtggaggctggtgcgtgggaagtgctgctctaagtggttatgacttgctgtcaagatggacagcagacagacttgatgctgtcgtcgtatcaaccaactacagattagcacctaagtatcatttcccaattcaatttgaagatgtatataatgccttaaggtggttcttacgtaaaaaagttcttgcaaaatatggtgtgaaccctgagagaatcggtatttctggagatagtgcaggagggaatttagctgcagcagtgactcaacagctccttgatgacccagatgtcaagatcaaactcaagatccagtctttaatttatcctgcccttcagcctcttgatgtagatttaccgtcatatcaagaaaattcaaattttctatttctatccaaatcactcatggtcagattctggagtgaatattttaccactgatagatcacttgaaaaagccatgctttccagacaacatgtacctgtggaatcaagtcatctcttcaaatttgttaattggagttccctgctccctgagaggtttataaaaggacatgtttataacaatccaaattatggcagttctgagctggctaaaaaatatccagggttcctagatgtgagggcagcccctttgttggctgatgacaacaaattacgtggcttacccctgacctatgtcatcacctgtcaatatgatctcttaagagatgatggactcatgtatgtcacccgacttcgcaacactggggttcaggtgactcataaccatgttgaggatggattccatggagcattttcatttctgggacttaaaattagtcacagacttataaatcagtatattgagtggctaaaggaaaatctatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 2 open reading frame 24
- chromosome 1 open reading frame 62
- mitochondrial ribosomal protein L37
- protein arginine methyltransferase 2

Buy AADAC-arylacetamide deacetylase (esterase) Gene now

Add to cart