PRMT2-protein arginine methyltransferase 2 Gene View larger

PRMT2-protein arginine methyltransferase 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRMT2-protein arginine methyltransferase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRMT2-protein arginine methyltransferase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000727
Product type: DNA & cDNA
Ncbi symbol: PRMT2
Origin species: Human
Product name: PRMT2-protein arginine methyltransferase 2 Gene
Size: 2ug
Accessions: BC000727
Gene id: 3275
Gene description: protein arginine methyltransferase 2
Synonyms: histone-arginine N-methyltransferase PRMT2; PRMT2 gamma; PRMT2 beta; PRMT2 alpha; protein arginine N-methyltransferase 2; HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1; HMT1 hnRNP methyltransferase-like 1; protein arginine methyltransferase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaacatcaggtgactgtcccagaagtgaatcgcagggagaagagcctgctgagtgcagtgaggcgggtctcctgcaggagggagtacagccagaggagtttgtggccatcgcggactacgctgccaccgatgagacccagctcagttttttgagaggagaaaaaattcttatcctgagacaaaccactgcagattggtggtggggtgagcgtgcgggctgctgtgggtacattccggcaaaccatgtggggaagcacgtggatgagtacgaccccgaggacacgtggcaggatgaagagtacttcggcagctatggaactctgaaactccacttggagatgttggcagaccagccacgaacaactaaataccacagtgtcatcctgcagaataaagaatccctgacggataaagtcatcctggacgtgggctgtgggactgggatcatcagtctcttctgtgcacactatgcgcggcctagagcggtgtacgcggtggaggccagtgagatggcacagcacacggggcagctggtcctgcagaacggctttgctgacatcatcaccgtgtaccagcagaaggtggaggatgtggtgctgcccgagaaggtggacgtgctggtgtctgagtggatggggacctgcctgctgtttgagttcatgatcgagtccatcctgtatgcccgggatgcctggctgaaggaggacggggtcatttggcccaccatggctgcgttgcaccttgtgccctgcagtgctgataaggattatcgtagcaaggtgctcttctgggacaacgcgtacgagttcaacctcagcgctctgaaatctttagcagttaaggagtttttttcaaagcccaagtataaccacattttgaaaccagaagactgtctctctgaaccgtgcactatattgcagttggacatgagaaccgtgcaaatttctgatctagagaccctgaggggcgagctgcgcttcgacatcaggaaggcggggaccctgcacggcttcacggcctggtttagcgtccacttccagagcctgcaggaggggcagccgccgcaggtgctcagcaccgggcccttccaccccaccacacactggaagcagacgctgttcatgatggacgacccagtccctgtccatacaggagacgtggtcacgggttcagttgtgttgcagagaaacccagtgtggataaggcacatgtctgtggctctgagctgggctgtcacttccagacaagaccccacatctcaaaaagttggagaaaaagtcttccccatctggagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, SWIM-type containing 1
- IKAROS family zinc finger 2 (Helios)
- solute carrier family 41, member 3
- chromosome 8 open reading frame 41

Buy PRMT2-protein arginine methyltransferase 2 Gene now

Add to cart