MRPL37-mitochondrial ribosomal protein L37 Gene View larger

MRPL37-mitochondrial ribosomal protein L37 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL37-mitochondrial ribosomal protein L37 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL37-mitochondrial ribosomal protein L37 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000041
Product type: DNA & cDNA
Ncbi symbol: MRPL37
Origin species: Human
Product name: MRPL37-mitochondrial ribosomal protein L37 Gene
Size: 2ug
Accessions: BC000041
Gene id: 51253
Gene description: mitochondrial ribosomal protein L37
Synonyms: L2mt; L37mt; MRP-L2; MRP-L37; MRPL2; RPML2; 39S ribosomal protein L37, mitochondrial; 39S ribosomal protein L2, mitochondrial; ribosomal protein, mitochondrial, L2; mitochondrial ribosomal protein L37
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcattggcgtccgggcccgcaaggcgggcgctagctggctccgggcagctcggccttgggggcttcggggccccgagacgcggggcgtatgagtggggcgtgcgctccacgcgtaagtcggagcctcctcccctggatagggtgtacgagatccctggactggagcccatcacctttgcggggaagatgcacttcgtgccctggctggcgcggccgatctttccgccctgggaccgcggctacaaggacccaaggttctaccgctcgccccctcttcacgagcatccgctgtacaaagaccaggcctgctatatctttcaccaccgttgccgccttctcgagggtgtaaagcaggccctctggctcaccaagaccaagttaatagaaggccttcccgagaaagtgcttagccttgttgatgatccaaggaaccacatagagaaccaagacgagtgcgttctgaatgtgatctctcacgcccgtctctggcagaccactgaggaaatccccaagagagagacctactgcccggtcatcgtggacaacctaatacagctgtgtaaatctcagattctcaagcatccttctctggccaggaggatctgtgtccaaaactccacgttttctgctacctggaaccgagagtctcttctccttcaagtccgtggttctggtggagcccgactgagcactaaggatcctctgcccaccatcgcctccagagaggagattgaagctactaagaatcatgttctagagaccttctaccccatatcacccatcatcgatcttcatgaatgcaatatttatgatgtgaaaaatgacacaggattccaggaaggctatccttacccctatccccataccctgtacttactggacaaagccaatttacgaccacaccgccttcaaccagatcagctgcgggccaagatgatcctgtttgcttttggcagtgccctggctcaggcccggctcctctatgggaatgatgccaaggtcttggagcagcccgtggtggtgcagagcgtgggcacggatggacgtgtcttccatttcctagtgtttcaactgaataccacagacctggactgtaacgagggtgtcaagaatttggcctgggtggactcagaccagctcctctatcagcatttttggtgtctcccagtgatcaaaaagagagtggttgtggaacctgttgggccagttggtttcaagccagagacattcagaaagtttttagctctatatttgcatggtgctgcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein arginine methyltransferase 2
- zinc finger, SWIM-type containing 1
- IKAROS family zinc finger 2 (Helios)
- solute carrier family 41, member 3

Buy MRPL37-mitochondrial ribosomal protein L37 Gene now

Add to cart