C1orf62-chromosome 1 open reading frame 62 Gene View larger

C1orf62-chromosome 1 open reading frame 62 Gene

PTXBC030647

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf62-chromosome 1 open reading frame 62 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf62-chromosome 1 open reading frame 62 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030647
Product type: DNA & cDNA
Ncbi symbol: C1orf62
Origin species: Human
Product name: C1orf62-chromosome 1 open reading frame 62 Gene
Size: 2ug
Accessions: BC030647
Gene id: 254268
Gene description: chromosome 1 open reading frame 62
Synonyms: C1orf62; protein AKNAD1; AKNA domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgaggctgatttttcagaacacacgacttataagcaggaggatttgccttatgatggggacctctctcagattaagataggcaatgattacagttttacctcaaaaaaggatggccttgaagtcttaaatcaaattattttcatagcagatgaccctcaagagaaggctatgcatagtgagacttgtggaaatacagctgtgaccatacccctgggtaaaattactgaaaatgctgccaacaaaaaagacgagaaagagaaacaatgcactgcagctcttcatattccagcaaatgaaggagacgcttctaagtcaagcatttctgatattttacttcatcatctttccaaagagccattcttaagaggtcaaggcattgattgtgaaaccctcccagagatctcaaatgccgacagttttgaagaggaagctattattaaaagtattatttcatgttataataagaattcttggccaaaagaacaaaccccaggactcactgaccaactcaacccgaaaagggatggtgaaaacagcaataagcctggttctgccaccacgacagaggaaaatacctctgatttagaagggccagtggctgctggagatagcagccatcaagaaaatgtgaatgttctaactaaaaccaagggtccaggtgataaacaaaaaagttatcaagggcagtcaccccagaaacagcagactgaaaaagcaaattcaggcaacacgttcaaatacggccaaggtcaagttcattaccagctccctgatttctctaagattgctcccaaagtgaaaattcctaaaaataagataattaataaaccacttgcaatagctaaacaagccagcttttcttccaagtcgagagataaacccactcttgtgcaagatagtctagaaaccacgcctgagtcaaactgtgttgaaaaacaacatcaagagcagaaagggaaaatcactgaaccttcacaacaaatccagatggagcccatagtacatatccaccaagaacttctcacaggaatagaatctgaggcaagtctctctaagttgtcaccaacctctcagaaaggcacttcctcaagttcttcttacatatttcaaaagatatcccaagggaaacagatgtgtcagaagttgaaagaacagactgatcaactgaagactaaagtacaagaattttccaaaagaataaaacaggactctccttaccatttgcaagacaagaagctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L37
- protein arginine methyltransferase 2
- zinc finger, SWIM-type containing 1
- IKAROS family zinc finger 2 (Helios)

Buy C1orf62-chromosome 1 open reading frame 62 Gene now

Add to cart