C9orf68-chromosome 9 open reading frame 68 Gene View larger

C9orf68-chromosome 9 open reading frame 68 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf68-chromosome 9 open reading frame 68 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf68-chromosome 9 open reading frame 68 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034293
Product type: DNA & cDNA
Ncbi symbol: C9orf68
Origin species: Human
Product name: C9orf68-chromosome 9 open reading frame 68 Gene
Size: 2ug
Accessions: BC034293
Gene id: 55064
Gene description: chromosome 9 open reading frame 68
Synonyms: C9orf68; bA6J24.2; spermatogenesis associated 6-like protein; spermatogenesis associated 6 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctctggaggtggtggtggagctgcagatccgggcgatttcttgcccaggagtgttcctgcctggcaaacaagatgtgtacctcggggtctacctcatgaatcagtacctggagaccaacagctttccctctgcgttccccattatgattcaggagagcatgagatttgaaaaggtatttgaaagtgcagtagatcctggagctgtagtagaccttttggaaatgtgggatgagttggcctactacgaagaaaacacacgagattttcttttcccagagcccaagctgacaccttcgcaccctaggaggtgtagggaggtgctcatgaagacggctctgggttttccaggcattgctcccaaaatagagttttctacaaggacagccatcagagaatgtgtgtttctgcatagaaacagatttcttgaagaaagacatgagtcacggaggcctttatctacatcacatgaaccaatatttcccttaaatactataaagatgaaactaagggagaataatctcaacagactgcccaaaggcatgcaagcccgggcgccctctcagtattctaccaggcatttcttccaggaccagccagctcagttgaaccttggaaataatttcaaaatctctggaggaagcaagcctccatttgttgttagacacgtggacagtgcaaagccctttggtgagaatatttcagagcatcatttgaggaggtctggaagaaaatctaagttttcagactttccgtttccaacgagaagagcttcttctcttgacagccttgcagctaacgtaaaggttatcaaagagccagatgaacggattgttttaaggagtgactcatcatcatgtttagattcaagtcagtttggaaagtcttcatccagtaaacaaggggatgctgatttccacgggaaagcttcatttgccacctaccagcattccacctctcctggccccttggatcagccccttctcagagaaaggttccatcctggttctcagtccacatggaagaatatccatgagagggtatgcagtcttctgacatcccacagagcacagctgcaccaaaacaaggaagattctacctctgaagtaaattatatcattgaaagaccaagctaccctctgaagaaatactcactgcatgaacagagatatttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - arylacetamide deacetylase (esterase)
- chromosome 2 open reading frame 24
- chromosome 1 open reading frame 62
- mitochondrial ribosomal protein L37

Buy C9orf68-chromosome 9 open reading frame 68 Gene now

Add to cart