RCL1-RNA terminal phosphate cyclase-like 1 Gene View larger

RCL1-RNA terminal phosphate cyclase-like 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RCL1-RNA terminal phosphate cyclase-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RCL1-RNA terminal phosphate cyclase-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001025
Product type: DNA & cDNA
Ncbi symbol: RCL1
Origin species: Human
Product name: RCL1-RNA terminal phosphate cyclase-like 1 Gene
Size: 2ug
Accessions: BC001025
Gene id: 10171
Gene description: RNA terminal phosphate cyclase-like 1
Synonyms: RNAC; RPCL1; RNA 3'-terminal phosphate cyclase-like protein; RNA cyclase homolog; RNA terminal phosphate cyclase like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgactcaggcgcactccctcagctacgcagggtgcaacttcttgcgccaacgtctggtcctgtctaccctgagcgggcgccccgtcaaaatccgaaagattcgggccagagacgacaacccgggcctccgagattttgaagccagcttcataaggctattggacaaaataacgaatggttctcgaattgaaataaaccaaacaggaacaaccttatattatcagcctggcctcctgtatggtggatctgtggaacatgactgtagcgtccttcgtggcattgggtattacctggagagtcttctttgcttggctccatttatgaagcacccgttaaaaatagttctacgaggagtgaccaatgatcaggttgacccttcagttgatgttcttaaggcaacagcactccctttgttgaaacaatttgggattgatggtgaatcatttgaactgaagattgtgcgacggggaatgcctcccggaggaggaggcgaagtggttttctcatgtcctgtgaggaaggtcttgaagcccattcaactcacagatccaggaaaaatcaaacgtattagaggaatggcgtactctgtacgtgtgtcacctcagatggcgaaccggattgtggattctgcaaggagcatcctcaacaagttcatacctgatatctatatttacacagatcacatgaaaggagtcaactctgggaagtctccgggctttgggttgtcactggttgctgagaccaccagtggcaccttcctcagtgctgaactggcctccaacccccagggccagggagcagcagtacttccagaggaccttggcaggaactgtgcccggctgctgctggaggaaatctacaggggtggatgcgtagactcgaccaaccaaagcctggcgctactactcatgacccttggacagcaggatgtttccaaagtcctgctaggccctctctctccctacacgatagaatttttgcggcatttgaagagctttttccagattatgtttaaaattgaaaccaagccatgtggtgaagaactcaagggtggggataaagtgctgatgacctgtgttggcattggtttctccaaccttagcaagaccctcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled estrogen receptor 1
- chromosome 20 open reading frame 4
- protein phosphatase methylesterase 1
- KTEL (Lys-Tyr-Glu-Leu) containing 1

Buy RCL1-RNA terminal phosphate cyclase-like 1 Gene now

Add to cart