GPER-G protein-coupled estrogen receptor 1 Gene View larger

GPER-G protein-coupled estrogen receptor 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPER-G protein-coupled estrogen receptor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPER-G protein-coupled estrogen receptor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011634
Product type: DNA & cDNA
Ncbi symbol: GPER
Origin species: Human
Product name: GPER-G protein-coupled estrogen receptor 1 Gene
Size: 2ug
Accessions: BC011634
Gene id: 2852
Gene description: G protein-coupled estrogen receptor 1
Synonyms: GPER; CEPR; CMKRL2; DRY12; FEG-1; GPCR-Br; GPR30; LERGU; LERGU2; LyGPR; mER; G-protein coupled estrogen receptor 1; G protein-coupled receptor 30; IL8-related receptor DRY12; chemoattractant receptor-like 2; chemokine receptor-like 2; constitutively expressed peptide-like receptor; flow-induced endothelial G-protein coupled receptor 1; heptahelix receptor; leucine rich protein in GPR30 3'UTR; lymphocyte-derived G-protein coupled receptor; membrane estrogen receptor; G protein-coupled estrogen receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgtgacttcccaagcccggggcgtgggcctggagatgtacctaggcaccgcgcagcctgcggcccccaacaccacctcccccgagctcaacctgtcccacccgctcctgggcaccgccctggccaatgggacaggtgagctctcggagcaccagcagtacgtgatcggcctgttcctctcgtgcctctacaccatcttcctcttccccatcggctttgtgggcaacatcctgatcctggtggtgaacatcagcttccgcgagaagatgaccatccccgacctgtacttcatcaacctggcggtggcggacctcatcctggtggccgactccctcattgaggtgttcaacctgcacgagcggtactacgacatcgccgtcctgtgcaccttcatgtcgctcttcctgcaggtcaacatgtacagcagcgtcttcttcctcacctggatgagcttcgaccgctacatcgccctggccagggccatgcgctgcagcctgttccgcaccaagcaccacgcccggctgagctgtggcctcatctggatggcatccgtgtcagccacgctggtgcccttcaccgccgtgcacctgcagcacaccgacgaggcctgcttctgtttcgcggatgtccgggaggtgcagtggctcgaggtcacgctgggcttcatcgtgcccttcgccatcatcggcctgtgctactccctcattgtccgggtgctggtcagggcgcaccggcaccgtgggctgcggccccggcggcagaaggcgctccgcatgatcctcgcggtggtgctggtcttcttcgtctgctggctgccggagaacgtcttcatcagcgtgcacctcctgcagcggacgcagcctggggccgctccctgcaagcagtctttccgccatgcccaccccctcacgggccacattgtcaacctcgccgccttctccaacagctgcctaaaccccctcatctacagctttctcggggagaccttcagggacaagctgaggctgtacattgagcagaaaacaaatttgccggccctgaaccgcttctgtcacgctgccctgaaggccgtcattccagacagcactgagcagtcggatgtgaggttcagcagtgccgtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 20 open reading frame 4
- protein phosphatase methylesterase 1
- KTEL (Lys-Tyr-Glu-Leu) containing 1
- chromosome 9 open reading frame 68

Buy GPER-G protein-coupled estrogen receptor 1 Gene now

Add to cart