Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GPER-G protein-coupled estrogen receptor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPER-G protein-coupled estrogen receptor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011634 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPER |
| Origin species: | Human |
| Product name: | GPER-G protein-coupled estrogen receptor 1 Gene |
| Size: | 2ug |
| Accessions: | BC011634 |
| Gene id: | 2852 |
| Gene description: | G protein-coupled estrogen receptor 1 |
| Synonyms: | GPER; CEPR; CMKRL2; DRY12; FEG-1; GPCR-Br; GPR30; LERGU; LERGU2; LyGPR; mER; G-protein coupled estrogen receptor 1; G protein-coupled receptor 30; IL8-related receptor DRY12; chemoattractant receptor-like 2; chemokine receptor-like 2; constitutively expressed peptide-like receptor; flow-induced endothelial G-protein coupled receptor 1; heptahelix receptor; leucine rich protein in GPR30 3'UTR; lymphocyte-derived G-protein coupled receptor; membrane estrogen receptor; G protein-coupled estrogen receptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgtgacttcccaagcccggggcgtgggcctggagatgtacctaggcaccgcgcagcctgcggcccccaacaccacctcccccgagctcaacctgtcccacccgctcctgggcaccgccctggccaatgggacaggtgagctctcggagcaccagcagtacgtgatcggcctgttcctctcgtgcctctacaccatcttcctcttccccatcggctttgtgggcaacatcctgatcctggtggtgaacatcagcttccgcgagaagatgaccatccccgacctgtacttcatcaacctggcggtggcggacctcatcctggtggccgactccctcattgaggtgttcaacctgcacgagcggtactacgacatcgccgtcctgtgcaccttcatgtcgctcttcctgcaggtcaacatgtacagcagcgtcttcttcctcacctggatgagcttcgaccgctacatcgccctggccagggccatgcgctgcagcctgttccgcaccaagcaccacgcccggctgagctgtggcctcatctggatggcatccgtgtcagccacgctggtgcccttcaccgccgtgcacctgcagcacaccgacgaggcctgcttctgtttcgcggatgtccgggaggtgcagtggctcgaggtcacgctgggcttcatcgtgcccttcgccatcatcggcctgtgctactccctcattgtccgggtgctggtcagggcgcaccggcaccgtgggctgcggccccggcggcagaaggcgctccgcatgatcctcgcggtggtgctggtcttcttcgtctgctggctgccggagaacgtcttcatcagcgtgcacctcctgcagcggacgcagcctggggccgctccctgcaagcagtctttccgccatgcccaccccctcacgggccacattgtcaacctcgccgccttctccaacagctgcctaaaccccctcatctacagctttctcggggagaccttcagggacaagctgaggctgtacattgagcagaaaacaaatttgccggccctgaaccgcttctgtcacgctgccctgaaggccgtcattccagacagcactgagcagtcggatgtgaggttcagcagtgccgtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 20 open reading frame 4 - protein phosphatase methylesterase 1 - KTEL (Lys-Tyr-Glu-Leu) containing 1 - chromosome 9 open reading frame 68 |