C20orf4-chromosome 20 open reading frame 4 Gene View larger

C20orf4-chromosome 20 open reading frame 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf4-chromosome 20 open reading frame 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf4-chromosome 20 open reading frame 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001751
Product type: DNA & cDNA
Ncbi symbol: C20orf4
Origin species: Human
Product name: C20orf4-chromosome 20 open reading frame 4 Gene
Size: 2ug
Accessions: BC001751
Gene id: 25980
Gene description: chromosome 20 open reading frame 4
Synonyms: C20orf4; CGI-23; protein AAR2 homolog; AAR2 splicing factor homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgccgtgcagatggatcctgagctagccaagcgcctcttctttgaaggggccactgtggtcatcctgaacatgcccaagggaacagagtttgggattgactataactcctgggaggtcgggcccaagttccggggcgtgaagatgatccctccaggcatccacttcctccactacagctctgtggacaaggctaatccgaaggaagtaggccctcgtatgggtttcttccttagcctgcaccagcgggggctgacagtgctgcgctggagcacactcagggaagaggtagacctgtccccagccccagagtctgaggtggaggccatgagggccaacctccaggagctggaccagttcctggggccttacccatatgccaccctgaagaagtggatctcactcaccaacttcatcagcgaagccacagtggagaagctacagcccgagaatcgacagatctgtgccttttccgatgtgctacctgtgctctccatgaagcacaccaaggaccgcgtggggcagaatctaccccgctgtggcattgagtgcaaaagctaccaagagggcctggcccggctaccagagatgaagcccagagccgggacagagatccgcttctcagagctgcccacgcagatgttcccagagggtgccacgccagctgagataaccaagcacagcatggacctgagctatgccctggagactgtgctcaacaagcagttccccagcagcccccaggatgtgcttggtgaactccagtttgcttttgtgtgcttcctgctggggaatgtgtacgaggcatttgagcattggaagcggctcctgaacctcctgtgccggtcagaagcagccatgatgaagcaccacaccctctacatcaacctcatctccatcctgtaccaccagcttggtgagatccccgctgacttcttcgtagacattgtctcccaagacaacttcctcaccagcaccttacaggttttcttttcctctgcctgcagcattgccgtggatgccaccctgagaaagaaagctgaaaagttccaagctcacctgaccaagaagttccggtgggactttgctgcggaacctgaggactgtgccccggtggtggtggagctccctgagggcatcgagatgggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase methylesterase 1
- KTEL (Lys-Tyr-Glu-Leu) containing 1
- chromosome 9 open reading frame 68
- arylacetamide deacetylase (esterase)

Buy C20orf4-chromosome 20 open reading frame 4 Gene now

Add to cart