PARP6-poly (ADP-ribose) polymerase family, member 6 Gene View larger

PARP6-poly (ADP-ribose) polymerase family, member 6 Gene

PTXBC026955

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PARP6-poly (ADP-ribose) polymerase family, member 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PARP6-poly (ADP-ribose) polymerase family, member 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026955
Product type: DNA & cDNA
Ncbi symbol: PARP6
Origin species: Human
Product name: PARP6-poly (ADP-ribose) polymerase family, member 6 Gene
Size: 2ug
Accessions: BC026955
Gene id: 56965
Gene description: poly (ADP-ribose) polymerase family, member 6
Synonyms: ARTD17; PARP-6-B1; PARP-6-C; pART17; poly [ADP-ribose] polymerase 6; ADP-ribosyltransferase diphtheria toxin-like 17; PARP-6; poly(ADP-ribose) polymerase family member 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttacatcccaacaatggaaacatctgagcaatgatttcttgaagacccagcaggagaagaggcacagttggttcaaggcaagtggtaccatcaagaagttccgagctggcctcagcatcttttcacccatccccaagtctcccagtttccctatcatacaggactccatgctgaaaggcaaactaggtgtaccagagcttcgggttgggcgcctcatgaaccgttccatctcctgtaccatgaagaaccccaaagtggaagtgtttggctaccctcccagcccccaggtcagtggtcactgcaagaacattcccactctggagtatggattcctcgttcagatcatgaagtatgcagaacagaggattccaacattgaatgagtactgtgtggtgtgtgatgagcagcatgtcttccaaaatggatctatgctgaagccagctgtctgtactcgtgaactatgcgttttctccttctacacactgggcgtcatgtctggagctgcagaggaggtggccactggagcagaggtggtggatctgctggtggccatgtgtagggcagctttagagtcccctagaaagagcatcatctttgagccttatccctctgtggtggaccccactgatcccaagactctggcctttaaccctaagaagaagaattatgagcggcttcagaaagctctggatagtgtgatgtctattcgggagatgacccagggctcatatttggaaatcaagaaacagatggacaagttggatcccctggcccatcctctcctgcagtggatcatctctagcaacaggtcacacattgtcaaactacctctcagcaggctgaagttcatgcacacctcacaccagttcctcctgctgagcagccctcctgccaaggaggctcggttccggaccgccaagaagctctatggcagcacctttgccttccatgggtcccacattgagaactggcattcgatcctgcgcaatgggctggtcaatgcatcctacaccaaactgcaggaatgggaaaaggacagcacaggatgccctccaaggatgagctggtccagagatacaacaggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor suppressing subtransferable candidate 1
- minichromosome maintenance complex component 7
- family with sequence similarity 46, member C
- family with sequence similarity 53, member C

Buy PARP6-poly (ADP-ribose) polymerase family, member 6 Gene now

Add to cart