Login to display prices
Login to display prices
MCM7-minichromosome maintenance complex component 7 Gene View larger

MCM7-minichromosome maintenance complex component 7 Gene

PTXBC009398

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MCM7-minichromosome maintenance complex component 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MCM7-minichromosome maintenance complex component 7 Gene

Proteogenix catalog: PTXBC009398
Ncbi symbol: MCM7
Product name: MCM7-minichromosome maintenance complex component 7 Gene
Size: 2ug
Accessions: BC009398
Gene id: 4176
Gene description: minichromosome maintenance complex component 7
Synonyms: DNA replication licensing factor MCM7; CDC47; MCM2; P1.1-MCM3; P1CDC47; P85MCM; PNAS146; PPP1R104; CDC47 homolog; homolog of S. cerevisiae Cdc47; minichromosome maintenance deficient 7; protein phosphatase 1, regulatory subunit 104; minichromosome maintenance complex component 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcactgaaggactacgcgctagagaaggaaaaggttaagaagttcttacaagagttctaccaggatgatgaactcgggaagaagcagttcaagtatgggaaccagttggttcggctggctcatcgggaacaggtggctctgtatgtggacctggacgacgtagccgaggatgaccccgagttggtggactcaatttgtgagaatgccaggcgctacgcgaagctctttgctgatgccgtacaagagctgctgcctcagtacaaggagagggaagtggtaaataaagatgtcctggacgtttacattgagcatcggctaatgatggagcagcggagtcgggaccctgggatggtccgaagcccccagaaccagtaccctgctgaactcatgcgcagatttgagctgtattttcaaggccctagcagcagcaagcctcgtgtgatccgggaagtgcgggctgactctgtggggaagttggtaactgtgcgtggaatcgtcactcgtgtctctgaagtcaaacccaagatggtggtggccacttacacttgtgaccagtgtggggcagagacctaccagccgatccagtctcccactttcatgcctctgatcatgtgcccaagccaggagtgccaaaccaaccgctcaggagggcggctgtatctgcagacacggggctccagattcatcaaattccaggagatgaagatgcaagaacatagtgatcaggtgcctgtgggaaatatccctcgtagtatcacggtgctggtagaaggagagaacacaaggattgcccagcctggagaccacgtcagcgtcactggtattttcttgccaatcctgcgcactgggttccgacaggtggtacagggtttactctcagaaacctacctggaagcccatcggattgtgaagatgaacaagagtgaggatgatgagtctggggctggagagctcaccagggaggagctgaggcaaattgcagatgtgatatttgccaccgtccgtgaactggtctcagggggccgaagtgtccggttctctgaggcagagcagcgctgtgtatctcgtggcttcacacccgcccagttccaggcggctctggatgaatatgaggagctcaatgtctggcaggtcaatgcttcccggacacggatcacttttgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: