Login to display prices
Login to display prices
FAM53C-family with sequence similarity 53, member C Gene View larger

FAM53C-family with sequence similarity 53, member C Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM53C-family with sequence similarity 53, member C Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM53C-family with sequence similarity 53, member C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000259
Product type: DNA & cDNA
Ncbi symbol: FAM53C
Origin species: Human
Product name: FAM53C-family with sequence similarity 53, member C Gene
Size: 2ug
Accessions: BC000259
Gene id: 51307
Gene description: family with sequence similarity 53, member C
Synonyms: protein FAM53C; C5orf6; family with sequence similarity 53 member C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgataaccctgatcactgagcagctacagaagcagactctggatgagctgaaatgcacacgcttcagcatcagtctgcctttgcctgatcatgcagacatctccaactgtgggaactctttccagcttgtgtctgaaggtgcttcctggaggggcctgccccactgttcctgtgctgagttccaggacagcctcaacttcagctaccatccctcaggcctgagcctgcacctcagaccacccagtcggggaaactcccccaaggagcagcccttctcccaagtcctaagacctgagcccccagatccagagaagcttcctgtgccccctgcccctccatccaagaggcactgccgctcactctcagtgcccgtggacctgtctcgctggcagccggtgtggcggcccgccccctccaagctgtggactcccataaagcaccggggcagtggtggagggggtgggccgcaggtgcctcaccagagccccccaaagcgggtctccagcctcaggttcctccaagctcccagtgcctcttctcaatgtgccccagctcacagaccctacagccctcctttcttcagcctggccctggcccaagattcctctcgaccctgcgccgcctcccctcaaagtggctcctgggagagtgatgctgagtccttgtcaccttgcccacctcagcgccgcttctccctgtcacccagtctgggcccgcaggcaagccgcttcttgccctctgcccggagctctcccgcatcctccccagagctgccctggcgacctcgaggtctccgcaaccttccccgaagccgctcacagccttgtgatctggatgcccgcaaaactggggtcaagcggcgccacgaggaagacccccggcgtctgcggccttcgttggactttgacaagatgaatcagaaaccatactcaggaggtctttgtctccaagaaacagcccgggaaggcagcagcatctctccaccatggttcatggcctgtagccccccacccctctctgcttcctgcagccccactgggggttcctcccaggtgctgagtgaaagcgaagaggaggaggagggggctgtgcggtggggtcggcaggcgctgagcaagcggacactgtgccagcgggactttggggacctggacttgaatttgattgaggaaaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lipase A, lysosomal acid, cholesterol esterase
- microphthalmia-associated transcription factor
- creatine kinase, mitochondrial 2 (sarcomeric)
- family with sequence similarity 46, member A