CKMT2-creatine kinase, mitochondrial 2 (sarcomeric) Gene View larger

CKMT2-creatine kinase, mitochondrial 2 (sarcomeric) Gene

PTXBC029140

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CKMT2-creatine kinase, mitochondrial 2 (sarcomeric) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CKMT2-creatine kinase, mitochondrial 2 (sarcomeric) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029140
Product type: DNA & cDNA
Ncbi symbol: CKMT2
Origin species: Human
Product name: CKMT2-creatine kinase, mitochondrial 2 (sarcomeric) Gene
Size: 2ug
Accessions: BC029140
Gene id: 1160
Gene description: creatine kinase, mitochondrial 2 (sarcomeric)
Synonyms: SMTCK; creatine kinase S-type, mitochondrial; S-MtCK; basic-type mitochondrial creatine kinase; creatine kinase, mitochondrial 2 (sarcomeric); mib-CK; sarcomeric mitochondrial creatine kinase; creatine kinase, mitochondrial 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagtatcttttctaagttgctaactggccgcaatgcttctctgctgtttgctaccatgggcaccagtgtcctgaccaccgggtacctgctgaaccggcagaaagtgtgtgccgaggtccgggagcagcctaggctatttcctccaagcgcagactacccagacctgcgcaagcacaacaactgcatggccgagtgcctcacccccgccatttatgccaagcttcgcaacaaggtgacacccaacggctacacgctggaccagtgcatccagactggagtggacaaccctggccaccccttcataaagactgtgggcatggtggctggtgacgaggagtcctatgaggtgtttgctgacctttttgaccccgtcatcaaactaagacacaacggctatgaccccagggtgatgaagcacacaacggatctggatgcatcaaagatcacccaagggcagttcgacgagcattacgtgctgtcttctcgggtgcgcactggccgcagcatccgtgggctgagcctgcctccagcctgcacccgggccgagcgaagggaggtagagaacgtggccatcactgccctggagggcctcaagggggacctggctggccgctactacaagctgtccgagatgacggagcaggaccagcagcggctcatcgatgaccactttctgtttgataagccagtgtcccctttattaacatgtgctgggatggcccgtgactggccagatgccaggggaatctggcataattatgataagacatttctcatctggataaatgaggaggatcacaccagggtaatctcaatggaaaaaggaggcaatatgaaacgagtatttgagcgattctgtcgtggactaaaagaagtagaacggttaatccaagaacgaggctgggagttcatgtggaatgagcgcctaggatacattttgacctgtccttcgaaccttggaacaggactacgagctggtgtccacgttaggatcccaaagctcagcaaggacccacgcttttctaagatcctggaaaacctaagactccagaagcgtggcacaggtggtgtggacactgccgcggtcgcagatgtgtacgacatttccaacatagatagaattggtcgatcagaggttgagcttgttcagatagtcatcgatggagtcaattacctggtggattgtgaaaagaagttggagagaggccaagatattaaggtgccaccccctctgcctcagtttggcaaaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 46, member A
- chromatin assembly factor 1, subunit B (p60)
- family with sequence similarity 71, member A
- Wolf-Hirschhorn syndrome candidate 1-like 1

Buy CKMT2-creatine kinase, mitochondrial 2 (sarcomeric) Gene now

Add to cart